ID: 984697010

View in Genome Browser
Species Human (GRCh38)
Location 4:182789262-182789284
Sequence GATGCTGGCAATTTGACCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984697010_984697017 21 Left 984697010 4:182789262-182789284 CCACAGGTCAAATTGCCAGCATC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 984697017 4:182789306-182789328 AAAGTAGATTATGACGGACAGGG 0: 1
1: 0
2: 0
3: 16
4: 95
984697010_984697015 15 Left 984697010 4:182789262-182789284 CCACAGGTCAAATTGCCAGCATC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 984697015 4:182789300-182789322 AGCGAGAAAGTAGATTATGACGG 0: 1
1: 0
2: 0
3: 12
4: 157
984697010_984697016 20 Left 984697010 4:182789262-182789284 CCACAGGTCAAATTGCCAGCATC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 984697016 4:182789305-182789327 GAAAGTAGATTATGACGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 66
984697010_984697018 22 Left 984697010 4:182789262-182789284 CCACAGGTCAAATTGCCAGCATC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 984697018 4:182789307-182789329 AAGTAGATTATGACGGACAGGGG 0: 1
1: 0
2: 1
3: 7
4: 89
984697010_984697019 25 Left 984697010 4:182789262-182789284 CCACAGGTCAAATTGCCAGCATC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984697010 Original CRISPR GATGCTGGCAATTTGACCTG TGG (reversed) Exonic
901224995 1:7608195-7608217 GATGCTGCCCAGGTGACCTGAGG + Intronic
902641199 1:17767388-17767410 GATGCTGGCAACTTAGCCTCAGG + Intronic
909691886 1:78418160-78418182 CTTGCTGGCAATGTGACCTTGGG - Intronic
910154605 1:84200369-84200391 GATGCTGGATATTAGACCTTTGG + Intronic
913439462 1:118882572-118882594 GGAGCTGGCAATCTGACCTTAGG - Intergenic
916125342 1:161565535-161565557 GATGCTGGAAAATGGTCCTGGGG - Intergenic
916135228 1:161646925-161646947 GATGCTGGAAAATGGTCCTGGGG - Intronic
918693927 1:187518348-187518370 GGTGCTGGCTAGTTGACCTAAGG + Intergenic
919684119 1:200466103-200466125 TATGCTTGCAATTAGATCTGAGG + Intergenic
920693975 1:208167667-208167689 GCTGATGGCACTTTGGCCTGTGG - Intronic
921572583 1:216796827-216796849 GATGCTGACATTTTGAGCTTGGG - Intronic
922540559 1:226415730-226415752 GATTCTGGCAAATTGCCCTTTGG + Intergenic
923782623 1:237038707-237038729 GATTCAGGCCATGTGACCTGAGG + Intergenic
1064734378 10:18365903-18365925 GAATCTGTCAATTTGGCCTGTGG + Intronic
1064876180 10:19996633-19996655 GATGATGGAAATGTGACCTGAGG + Intronic
1066117138 10:32250571-32250593 TATGCTGGCACTTTGATCTCAGG + Intergenic
1069242072 10:66155053-66155075 GTGGCAGGCAATTTGGCCTGCGG + Intronic
1070779005 10:79126819-79126841 GATGCTGGGGATATGAGCTGAGG + Intronic
1073851165 10:107619835-107619857 GATGCTGGGAAGTTGTCTTGGGG + Intergenic
1074783752 10:116820914-116820936 GATGCTGGCATTTTGAAGGGTGG - Intergenic
1075193887 10:120337612-120337634 GATACTGGCAATCTGACAGGTGG + Intergenic
1076218833 10:128717030-128717052 GATGGTGGAAACTTGACATGAGG - Intergenic
1077910182 11:6566401-6566423 TGTGCTGGCAATTTGCCCTCTGG - Intronic
1078425580 11:11248099-11248121 GATGCTGGCACTTTGATCTTGGG - Intergenic
1079408782 11:20167311-20167333 GAAGCTGGCATTTGGACTTGAGG - Intergenic
1080369450 11:31618322-31618344 CATGCTGGCAACTTGACCTTGGG - Intronic
1081663941 11:44905597-44905619 GATGCTGTCAGTTTCCCCTGGGG + Intronic
1084204918 11:67585579-67585601 GGTGCTGGCACTTTTAGCTGAGG + Intronic
1084557099 11:69881752-69881774 GATCCAGGCAATGTGGCCTGGGG + Intergenic
1086955436 11:92930399-92930421 CATTCTGGCCATTTGACTTGGGG + Intergenic
1088115740 11:106310564-106310586 GATGCTGGCAATTCAACCACTGG + Intergenic
1090610413 11:128466170-128466192 GATGCTGGAAATATCTCCTGTGG - Intronic
1091613782 12:2033700-2033722 TTTGCTGGAGATTTGACCTGGGG - Intronic
1093742127 12:22700820-22700842 GATGCTGGCAGGAGGACCTGAGG - Intergenic
1095497385 12:42799262-42799284 GCTGCTGGGAAATTGCCCTGTGG + Intergenic
1096688942 12:53307684-53307706 GATGTGGGCAATTCGGCCTGTGG + Exonic
1099017906 12:77367105-77367127 GATGCTTCCCATTTGACCTGTGG + Intergenic
1099821548 12:87717356-87717378 GATGCTGGCATTCTGATCTCAGG + Intergenic
1099904140 12:88751783-88751805 TATTCTGGCAATTTGAGCTGAGG + Intergenic
1103242120 12:119422444-119422466 GATGCTGGCATCTGGTCCTGGGG + Intronic
1109325687 13:60864947-60864969 GATGCTGGATATTAGACCTTTGG + Intergenic
1110324985 13:74203342-74203364 GATGATGGCAAATTGAGCTTTGG + Intergenic
1110551096 13:76812339-76812361 GATGGTGGCCATGTGAGCTGTGG + Intergenic
1111403139 13:87767550-87767572 GCTGGTGGGAATTTGACATGGGG + Intergenic
1112888607 13:104205059-104205081 GCTGTAGGCATTTTGACCTGAGG + Intergenic
1113774414 13:112934672-112934694 GATGCTGTCACTGTGACTTGGGG + Intronic
1116785428 14:49282491-49282513 GATGCTGGCATTTTCAACTTGGG - Intergenic
1116822493 14:49639096-49639118 GATGCTGGCCATTTTATATGAGG - Intergenic
1119786490 14:77318248-77318270 GTGGCTGGCAATCTGACCTGTGG + Intronic
1121017682 14:90558320-90558342 GAAGCTGGGACTTTGGCCTGGGG - Intronic
1124406957 15:29401646-29401668 AATCCTGGGAATTTAACCTGTGG + Intronic
1124416000 15:29473771-29473793 GCTGCTGGCAAATTGACCTCAGG + Intronic
1127637109 15:60881496-60881518 GAGGCTGGCCATTAGAGCTGAGG + Intronic
1127661986 15:61108408-61108430 GAGGTTGGCAAACTGACCTGTGG + Intronic
1129108606 15:73324708-73324730 GAGGCTGGCCATCTGAGCTGAGG - Intronic
1130801014 15:87263216-87263238 GATGGTGGCAGTTTGACCAGGGG - Intergenic
1131020407 15:89093140-89093162 GATGCTGGAAATGTGACTTGGGG - Intronic
1136267334 16:29129502-29129524 GATGCTGGCAGCTTGTCCTGGGG - Intergenic
1137496415 16:48972455-48972477 AATGTTGGCAATTTGACCCCAGG + Intergenic
1137511184 16:49102101-49102123 GTTGCTGGCAAGTTGACATTTGG + Intergenic
1137520434 16:49190579-49190601 TATGCTGGCACATTTACCTGTGG + Intergenic
1139265751 16:65636725-65636747 GATACTAGCAGTTTGACCTTGGG - Intergenic
1139582094 16:67879820-67879842 GATGCAGGAAATAAGACCTGTGG - Intronic
1139692954 16:68652764-68652786 AATGCAGGCAAATTCACCTGTGG - Intronic
1142070626 16:88089825-88089847 GATGCTGGCGGCTTGTCCTGGGG - Intronic
1144191241 17:12848408-12848430 GATGCTGACAATGTGGCTTGAGG - Intronic
1151181907 17:72335276-72335298 GATTCTATCAATTTGACCAGTGG - Intergenic
1152453004 17:80395487-80395509 GATGCTGTCATTTTGTCCAGAGG - Exonic
1153175245 18:2364542-2364564 GTTGCTGGTAATGTGACCTTGGG - Intergenic
1153212160 18:2779230-2779252 GATGTTGGCTAGTTGAACTGGGG + Intronic
1155959045 18:31978338-31978360 CATCCTGGAGATTTGACCTGAGG + Intergenic
1156421427 18:36957543-36957565 GAACATGGCAATTTAACCTGGGG - Intronic
1157769930 18:50337107-50337129 GGTGTTGGCATTTTGTCCTGGGG + Intergenic
1160179007 18:76618473-76618495 AAGGCTGGCAATTCCACCTGAGG + Intergenic
1160765034 19:803817-803839 CAGGCTGGCACTTGGACCTGTGG + Intronic
1162358353 19:10201495-10201517 GATGATGGCAGTTTGGGCTGGGG - Intronic
1167034981 19:46989757-46989779 GATGCTGGCTGTTAGAGCTGAGG + Intronic
1167243906 19:48362591-48362613 GATGGTGGCAATAAGACCTCAGG + Intronic
1167924238 19:52810315-52810337 AATGCTGGCAATGTGGACTGCGG + Intronic
925806284 2:7652457-7652479 GGTGATGGCAATTTGACCAATGG - Intergenic
926055028 2:9769439-9769461 CATGCTGCCACTCTGACCTGTGG + Intergenic
927391801 2:22604570-22604592 CTTGCTGGCCATTTGACCTTGGG - Intergenic
929222967 2:39484405-39484427 GATGCTGGCACTTTGCCCTCAGG + Intergenic
931624344 2:64243488-64243510 GATTCTGGCAAATTGTGCTGGGG + Intergenic
931640797 2:64379442-64379464 GCCTCTGGCAATGTGACCTGTGG + Intergenic
931684998 2:64785185-64785207 GATGCTGGCAGTTGCTCCTGTGG - Intergenic
936406600 2:112210099-112210121 GGTGATGGCAATCTGACATGAGG + Intergenic
936960548 2:118069297-118069319 AATGCTGCCAATTTGACTTAAGG - Intergenic
940935730 2:159492255-159492277 CATGGTGTCACTTTGACCTGGGG - Intronic
941316829 2:164003911-164003933 GATGCTGGCAATGGAACCAGTGG - Intergenic
941856271 2:170234320-170234342 GATGCCAGCACTTTGACCTTAGG - Intronic
943956298 2:194195024-194195046 TATTTTTGCAATTTGACCTGAGG - Intergenic
944691366 2:202161392-202161414 GATGCTTGGAATTTAACCAGAGG - Intronic
945576753 2:211540486-211540508 GATGATGGCATTTTAAGCTGAGG + Intronic
947710012 2:232308062-232308084 GAAGCTGCCCATCTGACCTGGGG - Intronic
947818005 2:233050958-233050980 CATGCTGGCACTTTGATCTTGGG + Intergenic
1169756396 20:9047558-9047580 GATGCTGGATATTAGACCTTTGG - Intergenic
1171269526 20:23802862-23802884 GATGCTGGCAATTGGAAGTTGGG + Intergenic
1172754957 20:37277021-37277043 GATTCTGGGACCTTGACCTGGGG + Intergenic
1179267357 21:39816004-39816026 GATGATTGCAATTTTCCCTGTGG + Intergenic
1181422599 22:22812029-22812051 GATCCTGGCCGTTTGTCCTGGGG - Intronic
1181430902 22:22881145-22881167 GATGCTGGCTGTCTGTCCTGGGG - Intronic
1182569917 22:31229297-31229319 GAGCCTGGTAATTTGCCCTGGGG + Intronic
950535863 3:13577791-13577813 GCTGGTGGCAATGAGACCTGGGG - Intronic
953034155 3:39197109-39197131 CAGACTGGCAATTTGATCTGAGG - Intergenic
953799515 3:46011597-46011619 GATGCTGTCAATGTGAGCTGAGG - Intergenic
956138940 3:66126326-66126348 GATGCTGGTCATTTGACATCAGG + Intergenic
957551939 3:81717632-81717654 GATACTAGCAATGTGACCTTTGG + Intronic
957795337 3:84997968-84997990 GCTGCTTGCAATTTTACTTGGGG - Intronic
959322188 3:104890779-104890801 GATGATGGCAACTTGGTCTGTGG + Intergenic
959551276 3:107661647-107661669 GAAGCTGGCAATCTGAACTTGGG - Intronic
959608165 3:108264588-108264610 TATGCTGGCACTTTGATCTCAGG + Intergenic
970394442 4:15652034-15652056 GACGTTGGCAATGTGACATGTGG - Intronic
970661709 4:18292817-18292839 GATGCTGAGAATCTGAACTGTGG + Intergenic
972819530 4:42683693-42683715 TATTCTGGTAATTTGACATGTGG + Intergenic
976790896 4:88877295-88877317 GAATCTGGCAATCTAACCTGAGG + Intronic
980162227 4:129179494-129179516 GCTGCTGCAAATTTGCCCTGGGG + Intergenic
980465224 4:133168516-133168538 TATTTTGACAATTTGACCTGTGG + Intronic
982360943 4:154518405-154518427 GATGTTGGCAATTTCAGATGGGG - Intergenic
983689426 4:170450584-170450606 GATGCTGACATCTTCACCTGTGG + Intergenic
984697010 4:182789262-182789284 GATGCTGGCAATTTGACCTGTGG - Exonic
989749938 5:44881271-44881293 GATGCACACAATTTGCCCTGAGG - Intergenic
991496855 5:67235283-67235305 GCTGCTGTCATTTTTACCTGTGG - Intergenic
994132525 5:96246693-96246715 GAAGCTGGCAATTTGAGGGGAGG - Intergenic
995397584 5:111703866-111703888 CATGCTGGCAATGTGAAATGAGG - Intronic
995521773 5:113014136-113014158 GATGCTGTGATTTTGAGCTGTGG + Exonic
998805570 5:145915024-145915046 GATGCTGGAAATTCCACTTGAGG - Intergenic
1004571411 6:16849389-16849411 GATCTGGGCAATTTGGCCTGTGG + Intergenic
1004868241 6:19875425-19875447 GATGCTGGCATTTGCTCCTGGGG - Intergenic
1011059815 6:83252016-83252038 GATGATAGCAATTTGCACTGGGG + Intronic
1012523412 6:100148190-100148212 CATACTGTCAATGTGACCTGAGG + Intergenic
1013049677 6:106520287-106520309 GATGCTGGCGGTATGACTTGTGG - Exonic
1018154767 6:160975281-160975303 GATGCTAGCAGTTTGATCTTGGG + Intergenic
1018593650 6:165454656-165454678 GATGCAGGCACCTTGACCTTGGG + Intronic
1019097668 6:169598340-169598362 GATTCTGGCTCTTTGACCTTGGG - Intronic
1026742260 7:72986222-72986244 AAGGGTGTCAATTTGACCTGGGG - Intergenic
1027028383 7:74870961-74870983 AAGGGTGTCAATTTGACCTGGGG - Intergenic
1027101475 7:75378856-75378878 AAGGGTGTCAATTTGACCTGGGG + Intergenic
1032859578 7:135864499-135864521 GATGCTGGCCCTTTGATCTTGGG - Intergenic
1033072355 7:138215663-138215685 GCTGCTGGCACTGTGACCTATGG - Intergenic
1034848949 7:154475735-154475757 GGTGCTGGCAACTTGGCCTGTGG - Intronic
1035757080 8:2042722-2042744 CAGGCTGCCAATTTGAGCTGTGG + Intergenic
1035839032 8:2790208-2790230 GTTGCTGGAAATTTTATCTGAGG - Intergenic
1036409684 8:8487927-8487949 GATGCTGGCACTGTGACCTCAGG - Intergenic
1038215531 8:25558574-25558596 GATGCTGGCAACTTGAATTAGGG - Intergenic
1040688523 8:49907065-49907087 TATGCTGCCAATTTGGCCTAGGG - Intergenic
1041643352 8:60226419-60226441 GATGCTGACAATGTGACTTATGG + Intronic
1044648531 8:94470106-94470128 AATTCTGGCAATTTAACCTAAGG + Intronic
1045490678 8:102666622-102666644 GATGATGGTACTTGGACCTGGGG - Intergenic
1047162439 8:122395704-122395726 CATACTGGCAATTTAACTTGAGG + Intergenic
1047707698 8:127517270-127517292 GAGGCTGGAAATTTGACATCAGG + Intergenic
1048543142 8:135361383-135361405 GATGCTGGCAGTTGGAAGTGAGG - Intergenic
1050529065 9:6572306-6572328 GATGCTGGGAAAATGACATGTGG + Intronic
1056954558 9:91071994-91072016 GATGCTGGGATTTTGAACTTGGG - Intergenic
1058751336 9:108041137-108041159 GTTGCTGGAGATTTGGCCTGGGG + Intergenic
1192493608 X:71598209-71598231 GCTGCTGGGAAATTGACCAGGGG - Intronic
1194091132 X:89582701-89582723 GATGCTGACAAATTGACTTTGGG - Intergenic
1196148500 X:112345701-112345723 GATGCTGGGAATAGTACCTGAGG - Intergenic
1197890119 X:131262089-131262111 AATGCTTGAAATTGGACCTGTGG - Intergenic
1199041652 X:143121508-143121530 TAAGCTGGTATTTTGACCTGAGG - Intergenic
1199444162 X:147901658-147901680 GGTGCTGGCAGGTTGCCCTGGGG - Intergenic
1200443774 Y:3238766-3238788 GATGCTGACAAATTGACTTTGGG - Intergenic
1201391145 Y:13498644-13498666 TATTCTGGCCTTTTGACCTGTGG + Intergenic