ID: 984697012

View in Genome Browser
Species Human (GRCh38)
Location 4:182789277-182789299
Sequence AGTGGTGCCTCGCTGGATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984697012_984697016 5 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697016 4:182789305-182789327 GAAAGTAGATTATGACGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 66
984697012_984697017 6 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697017 4:182789306-182789328 AAAGTAGATTATGACGGACAGGG 0: 1
1: 0
2: 0
3: 16
4: 95
984697012_984697020 22 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697020 4:182789322-182789344 GACAGGGGAGGATCGTGTCTCGG 0: 1
1: 0
2: 1
3: 6
4: 128
984697012_984697018 7 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697018 4:182789307-182789329 AAGTAGATTATGACGGACAGGGG 0: 1
1: 0
2: 1
3: 7
4: 89
984697012_984697015 0 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697015 4:182789300-182789322 AGCGAGAAAGTAGATTATGACGG 0: 1
1: 0
2: 0
3: 12
4: 157
984697012_984697021 23 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697021 4:182789323-182789345 ACAGGGGAGGATCGTGTCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 141
984697012_984697019 10 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984697012 Original CRISPR AGTGGTGCCTCGCTGGATGC TGG (reversed) Exonic
900186330 1:1334867-1334889 TGTGGTGCCTGGCAGGGTGCAGG - Exonic
901499139 1:9640860-9640882 AGTGGTGGCATGCTGGAGGCAGG - Intergenic
905901626 1:41585226-41585248 AGAGATGCCACGCTGGATGCTGG + Exonic
906117658 1:43366970-43366992 AGAGGTGCTTCTCTGGAAGCAGG - Intronic
913076504 1:115344761-115344783 AGTGGGGAATGGCTGGATGCAGG + Intergenic
917877862 1:179303047-179303069 TGAGGTCCCCCGCTGGATGCTGG + Intronic
921584094 1:216927728-216927750 ACTGGTGCCATACTGGATGCTGG + Intronic
1064670495 10:17708797-17708819 AGTGGTGCCTACCTGGTTGCAGG + Exonic
1068253186 10:54470383-54470405 AGTGGTGCCTGGCTGCAGGTGGG + Intronic
1075393727 10:122112541-122112563 AATGGTGCCTCGCTTGTTCCTGG - Intronic
1075805892 10:125188580-125188602 AGTGGTGCCTCGCTGGCAGCTGG + Intergenic
1076552297 10:131289409-131289431 AGGTGTGCCTTTCTGGATGCTGG - Intronic
1076835831 10:133020609-133020631 CCTGGTGCCTGGCTGGATGGGGG - Intergenic
1076854339 10:133108551-133108573 AGTGGTGCCTCCTTGGATTCAGG + Intronic
1077916717 11:6616364-6616386 AGTGTTGACCCGCTGGATGTAGG + Exonic
1079113345 11:17621172-17621194 AGTTTTGCCTTGTTGGATGCTGG + Intronic
1083295580 11:61713747-61713769 AGTGGTGCCCCGCAGGACACTGG - Intronic
1083852754 11:65377577-65377599 AGTCTTGCCTCTCTGGAGGCAGG - Intronic
1084590610 11:70087953-70087975 AAGGGGGCGTCGCTGGATGCAGG + Exonic
1090273353 11:125403149-125403171 AGAGGTGCCTGAATGGATGCAGG - Intronic
1091991143 12:4957016-4957038 AGTGCAGCCTTGCTGGAGGCAGG + Intergenic
1095286260 12:40414506-40414528 AGTGGTGCCTCTCTGGATGTGGG + Intronic
1096256543 12:50065321-50065343 AGGGGTGCCTAGCTGGGTGGAGG + Intronic
1097778866 12:63680698-63680720 AGCTGTGCCTGGCTGGATGATGG - Intergenic
1097839946 12:64312011-64312033 TGTGATGACTGGCTGGATGCTGG + Intronic
1103684513 12:122721209-122721231 AGGGCAGCCTCGCTGGATTCTGG + Intergenic
1105258065 13:18758027-18758049 AATGGTGCCTCCCTGTATGGGGG + Intergenic
1105263018 13:18793741-18793763 AATGGTGCCTCCCTGTATGGGGG + Intergenic
1107440865 13:40426058-40426080 AGAGGTGCCTGACTGGCTGCAGG - Intergenic
1108696970 13:52910823-52910845 AGTGGAACATGGCTGGATGCGGG - Intergenic
1114550295 14:23528855-23528877 ACTGGTGCCAGCCTGGATGCAGG - Intronic
1117066198 14:52015061-52015083 GGTGGTGCCTGGCTGGGAGCGGG + Exonic
1117514929 14:56491553-56491575 AGTGGTCCTTCGCTGGATCGGGG - Intronic
1119175566 14:72565604-72565626 AGAGGTCCCTCCCAGGATGCTGG - Intronic
1131050735 15:89346257-89346279 AGCTGTGCCTCCGTGGATGCTGG - Intergenic
1132089625 15:98937271-98937293 AGAGGTGCCTCAATCGATGCTGG - Intronic
1132767055 16:1539754-1539776 AGTGGTGCCTGCCTGTCTGCGGG + Intronic
1132849868 16:2020145-2020167 AGAGGAGCCTCGCGGGCTGCGGG - Exonic
1135240264 16:20799986-20800008 AGTGGTGCCTTGCAGGAAGTAGG - Exonic
1138351944 16:56350710-56350732 AGTGGTGGCACCCAGGATGCTGG + Intronic
1141760597 16:86026304-86026326 AGTGGGGCATCCCTGGATGAGGG + Intergenic
1143126081 17:4641602-4641624 ACTGGGGCCTCGCTCTATGCCGG - Exonic
1143866183 17:9925736-9925758 GGTGGTGCCACTCTGGCTGCTGG - Intronic
1146169866 17:30624725-30624747 AGTGATGCACTGCTGGATGCCGG + Intergenic
1146484389 17:33231415-33231437 AGAGGTGCATGGCTGGATGGGGG + Intronic
1150583911 17:66500287-66500309 AGTGTTGACTGGCTGTATGCAGG + Intronic
1154430737 18:14306554-14306576 AATGGTGCCTCCCTGTATGGGGG - Intergenic
1155216324 18:23646276-23646298 TGTGGTGCCATGCTGGATGGAGG + Exonic
1157444604 18:47735256-47735278 AGGGGTGCCATGCTGGATGGAGG - Intergenic
1158488852 18:57892211-57892233 ACTGGAGCCTAGCTGGAGGCTGG - Intergenic
1166140501 19:40802801-40802823 AGTGATGCCTGGCTGGCTGATGG + Intronic
928328817 2:30341626-30341648 AGTGGTGGCTCGCAGAATCCTGG + Intergenic
933787803 2:85857811-85857833 AGTGGGGCATGGCTGGATGCAGG + Intronic
935511099 2:103975228-103975250 AGGGGTGCCTCCCTGGAGGTTGG - Intergenic
947533352 2:230926390-230926412 AGGGGGGCCTCGCTGGGGGCAGG - Intronic
1173079339 20:39850861-39850883 AGGGGTGCCCCGCTGGCTTCAGG - Intergenic
1175966219 20:62661413-62661435 AGTGATGGCTCCCTGGGTGCGGG - Intronic
1179024061 21:37665930-37665952 AGTGGCCTCTCACTGGATGCAGG + Intronic
1179826419 21:43968618-43968640 AGTGGTGCCTGGCTGGTTGAGGG + Intronic
1180980914 22:19877589-19877611 AGAGGTGGCTGGCTGGATGTGGG - Intronic
1181099850 22:20531872-20531894 AGGGGTGCCTGGGTGGAAGCAGG + Intronic
1182482692 22:30619691-30619713 TGTGGGCCCTCCCTGGATGCAGG - Intronic
950457516 3:13101516-13101538 GGTGGTGCCTGGCTAGATGGTGG + Intergenic
951638785 3:24810828-24810850 AGTGATGCCTGGATGGAGGCAGG + Intergenic
952848025 3:37704672-37704694 ACCGGTGACTTGCTGGATGCTGG + Intronic
954195896 3:48997066-48997088 ACTTGTGCCTCTCTGGATTCTGG + Intronic
954759073 3:52861035-52861057 AGTGGTGCTTTGCAGGATGGAGG + Intronic
962499469 3:135975159-135975181 AGTGGAGGCTCACTGGGTGCTGG + Intronic
962663601 3:137630893-137630915 AATGGTGCCTTGCTTGATGTAGG + Intergenic
963110665 3:141685358-141685380 AGTGGTGTCACACTGAATGCAGG + Intergenic
967304739 3:188049583-188049605 AGTGATGCCTTGATGGAGGCAGG + Intergenic
969316308 4:6383258-6383280 AGTGGGGCCCTGCTGGAGGCTGG - Intronic
971180047 4:24321587-24321609 ATTGGTGCCTCTCTGGGTTCTGG - Intergenic
984501427 4:180564174-180564196 AGGGGGGCCTGGCTGGATGGAGG + Intergenic
984697012 4:182789277-182789299 AGTGGTGCCTCGCTGGATGCTGG - Exonic
985822507 5:2169886-2169908 AGCGCTGCCTCGGTGGGTGCGGG + Intergenic
986932684 5:12846227-12846249 AGTGCTGCCTTGCTGGAGGCAGG - Intergenic
987703480 5:21431711-21431733 AGTGGGGCCTCTCTGGGTGTGGG + Intergenic
990529997 5:56663853-56663875 AGTGGTGCCTTGCGGAATGAAGG - Intergenic
990988179 5:61660172-61660194 AATGGTGGCTAGATGGATGCAGG + Intronic
1000219675 5:159201283-159201305 AGTGGTCCGTCGGTGTATGCTGG - Intronic
1008333088 6:50266032-50266054 ACTGGTGCCTCCGTGGATGGTGG - Intergenic
1008673284 6:53794857-53794879 AGTCGACCCTCTCTGGATGCAGG + Intronic
1008691663 6:53986126-53986148 TGTGGTCCCTAGCTGGCTGCAGG - Intronic
1018869622 6:167770877-167770899 AGTGGGGCCTGTCTGGATGGAGG - Intergenic
1020115737 7:5475404-5475426 AGTGGTGGCTGGCTGAAGGCAGG - Intronic
1020498544 7:8887871-8887893 AGTGGGGCCTCACTAGATGACGG - Intergenic
1023827365 7:44018662-44018684 AGTGGCTCCTCGCTGCCTGCGGG - Intergenic
1023916806 7:44596115-44596137 TGTTCTGCCTCGCTGGATTCAGG - Intergenic
1024307694 7:47942087-47942109 TGAGGGGCCTGGCTGGATGCAGG - Intronic
1026493178 7:70880630-70880652 AGATGGGCCTGGCTGGATGCTGG + Intergenic
1028455542 7:91034408-91034430 AGTGGTGCTTGGCTGGACACAGG - Intronic
1029738521 7:102478409-102478431 AGTGGCTCCTCGCTGCCTGCGGG - Intronic
1029755651 7:102572072-102572094 AGTGGCTCCTCGCTGCCTGCGGG - Intronic
1029773600 7:102671152-102671174 AGTGGCTCCTCGCTGCCTGCGGG - Intronic
1030373302 7:108725442-108725464 AGTGTTACCTTGTTGGATGCTGG + Intergenic
1031410580 7:121436466-121436488 AGTGGTGCTTTGCTGAATGCAGG - Intergenic
1034492278 7:151399815-151399837 AGTGGCTCCCCGCTGGGTGCAGG - Intronic
1041314516 8:56547165-56547187 AGAGGGGCCTCCCTGGATGTGGG - Intergenic
1050416800 9:5426883-5426905 AGGAGAGCCTCGTTGGATGCTGG - Intronic
1056116651 9:83447486-83447508 AGAGGAGCCAGGCTGGATGCGGG + Intronic
1057875084 9:98747646-98747668 CATGGTGCCACGCTGGATGTGGG - Intronic
1058934022 9:109751074-109751096 AGGGTTGCCTGGCTGGATTCAGG - Intronic
1062270576 9:135706505-135706527 AGTGGTGCCTGGCAGGACACAGG - Intronic
1190439348 X:50462197-50462219 AGTGTTGCCTACCTGGATGATGG + Intronic
1190539840 X:51465843-51465865 AGTGGTGCCTAGCATGATCCAGG + Intergenic
1191110684 X:56801209-56801231 AGGGGTGCCTCACTGCATGGTGG - Intergenic
1200286990 X:154832548-154832570 AGTGGTTTCCCGCTGGATGTGGG - Intronic