ID: 984697013

View in Genome Browser
Species Human (GRCh38)
Location 4:182789284-182789306
Sequence TCTCGCTAGTGGTGCCTCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984697013_984697015 -7 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697015 4:182789300-182789322 AGCGAGAAAGTAGATTATGACGG 0: 1
1: 0
2: 0
3: 12
4: 157
984697013_984697019 3 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697013_984697017 -1 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697017 4:182789306-182789328 AAAGTAGATTATGACGGACAGGG 0: 1
1: 0
2: 0
3: 16
4: 95
984697013_984697020 15 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697020 4:182789322-182789344 GACAGGGGAGGATCGTGTCTCGG 0: 1
1: 0
2: 1
3: 6
4: 128
984697013_984697018 0 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697018 4:182789307-182789329 AAGTAGATTATGACGGACAGGGG 0: 1
1: 0
2: 1
3: 7
4: 89
984697013_984697022 29 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697022 4:182789336-182789358 GTGTCTCGGGTCTTTGCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 114
984697013_984697016 -2 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697016 4:182789305-182789327 GAAAGTAGATTATGACGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 66
984697013_984697021 16 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697021 4:182789323-182789345 ACAGGGGAGGATCGTGTCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984697013 Original CRISPR TCTCGCTAGTGGTGCCTCGC TGG (reversed) Exonic
900713655 1:4130394-4130416 TCTTGGTATTGGTGCCTCCCAGG - Intergenic
912251475 1:108016620-108016642 TCTCGGCAGTGGTGACTCACTGG - Intergenic
918003798 1:180523285-180523307 TCTGGCTACTGGTGGTTCGCTGG - Intergenic
1064147796 10:12839375-12839397 TCTTTCTAGTGGGGGCTCGCTGG + Intergenic
1075805890 10:125188573-125188595 TGTTGCCAGTGGTGCCTCGCTGG + Intergenic
1085638113 11:78173682-78173704 TCTCGCCAGTGGTGCGAGGCAGG - Exonic
1086850383 11:91800525-91800547 TGTGGCTGGTGGTGCCTCGGCGG - Intergenic
1093473930 12:19534207-19534229 TGCCCCTAGTCGTGCCTCGCTGG - Intronic
1105806218 13:23953109-23953131 TCTCGCTCTTGGTGCCTCCTTGG - Intergenic
1107149038 13:37090913-37090935 TCTGGCCAGTGTTGCCTGGCTGG - Intergenic
1108054066 13:46468314-46468336 TCTCACGGGTGGTGCCTCCCCGG - Intergenic
1113661128 13:112106965-112106987 TTTCGCAAGTGGGGCCTCGGGGG + Intergenic
1129738207 15:77977273-77977295 TCTCGGTAGTGGTGTCTCAATGG + Intergenic
1130254042 15:82317596-82317618 TCTCGGTAGTGGTGTCTCAATGG + Intergenic
1132155904 15:99495113-99495135 CCTCGCTCGTGGTGCCTCCTGGG - Intergenic
1132806071 16:1775722-1775744 TCAAGGTAGTGGTGCCTCCCCGG + Intronic
1141694686 16:85613873-85613895 GCTCGCTACTGGGGCCGCGCCGG + Intronic
1151556086 17:74847430-74847452 TCTTGCTGGTGGTGCCCCGCGGG + Exonic
1157323405 18:46651256-46651278 TCCCCCTAATGGTGCCTCGATGG - Intronic
1161210115 19:3061801-3061823 CCGGGCTAGAGGTGCCTCGCGGG + Intronic
1168419188 19:56190090-56190112 TCTCGCCAGTGTGGACTCGCTGG + Exonic
926814681 2:16788592-16788614 TCCTGCTGGTGGTGCCTTGCAGG + Intergenic
933760553 2:85669075-85669097 TCTCCCTAGTGGAGGCTCACAGG + Intergenic
934734157 2:96680042-96680064 TCTTGCTAGTCGTGTCCCGCAGG + Intergenic
935834512 2:107036513-107036535 TGTCGCTACTGGTGGCTGGCTGG - Intergenic
937362309 2:121237758-121237780 TCTGGCTGGTGGTCCCTCGTGGG - Intronic
1171459680 20:25291538-25291560 CCTCTTTAGTGGTGCCTGGCAGG + Intronic
1175870866 20:62208855-62208877 TTTCCTTAGTGGTGCCTCCCGGG + Intergenic
1178627601 21:34231270-34231292 TCTAGCAAGTGCTGCCTCACAGG - Intergenic
1179826417 21:43968611-43968633 GCTCGGCAGTGGTGCCTGGCTGG + Intronic
1180701044 22:17781586-17781608 CCTGGCTGGTGGTGCCTGGCTGG + Intergenic
1185134800 22:49063508-49063530 TCTTGGTAGTGCTTCCTCGCTGG - Intergenic
967904526 3:194488925-194488947 TCTAGCTAGAGCTGCCTGGCAGG - Intronic
968235209 3:197027283-197027305 ACTCTCTGGTGGTGCCTCGGAGG + Intronic
973549648 4:52020488-52020510 TCTCTCCAGTGGTGCTTCCCTGG - Intergenic
973783584 4:54314422-54314444 TCTCTCTAGTGCTGCCACCCTGG + Intergenic
984697013 4:182789284-182789306 TCTCGCTAGTGGTGCCTCGCTGG - Exonic
1000546493 5:162610032-162610054 TCTCGCAAGTGGTGGCTCCACGG - Intergenic
1003512265 6:6791346-6791368 TCTCACCAGTGGTGCCTGGAAGG + Intergenic
1020795907 7:12678259-12678281 TCACGCAAGTGCTGCCTCCCGGG - Intergenic
1024107478 7:46107907-46107929 TCTCGCTAGAGTTACCTGGCCGG + Intergenic
1027348637 7:77288038-77288060 CCTCACTAGTGGTGCCTGGTGGG - Intronic
1034063391 7:148113679-148113701 ACTAGCTAGAGGTGCCTCCCTGG + Intronic
1049698942 8:143998249-143998271 TCTCGCCAGTGATCCTTCGCTGG - Intronic