ID: 984697014

View in Genome Browser
Species Human (GRCh38)
Location 4:182789295-182789317
Sequence ATAATCTACTTTCTCGCTAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984697014_984697020 4 Left 984697014 4:182789295-182789317 CCACTAGCGAGAAAGTAGATTAT 0: 1
1: 0
2: 1
3: 1
4: 76
Right 984697020 4:182789322-182789344 GACAGGGGAGGATCGTGTCTCGG 0: 1
1: 0
2: 1
3: 6
4: 128
984697014_984697019 -8 Left 984697014 4:182789295-182789317 CCACTAGCGAGAAAGTAGATTAT 0: 1
1: 0
2: 1
3: 1
4: 76
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697014_984697022 18 Left 984697014 4:182789295-182789317 CCACTAGCGAGAAAGTAGATTAT 0: 1
1: 0
2: 1
3: 1
4: 76
Right 984697022 4:182789336-182789358 GTGTCTCGGGTCTTTGCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 114
984697014_984697023 28 Left 984697014 4:182789295-182789317 CCACTAGCGAGAAAGTAGATTAT 0: 1
1: 0
2: 1
3: 1
4: 76
Right 984697023 4:182789346-182789368 TCTTTGCTGATGGTAAAACATGG 0: 1
1: 0
2: 2
3: 19
4: 220
984697014_984697021 5 Left 984697014 4:182789295-182789317 CCACTAGCGAGAAAGTAGATTAT 0: 1
1: 0
2: 1
3: 1
4: 76
Right 984697021 4:182789323-182789345 ACAGGGGAGGATCGTGTCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984697014 Original CRISPR ATAATCTACTTTCTCGCTAG TGG (reversed) Exonic
904175886 1:28628446-28628468 CTAATCTACTTTCTGTCTATGGG - Intronic
908192052 1:61713581-61713603 TTAATCTACTTACTGGCTTGAGG - Intronic
921466633 1:215495851-215495873 CTAATCTACTTTCTTGCTTTGGG + Intergenic
923221163 1:231895043-231895065 TAAATCTACTATCTTGCTAGTGG + Intronic
924314927 1:242785742-242785764 ACAATCTACCTTTTCCCTAGTGG - Intergenic
1072834366 10:98695374-98695396 ATTTTCTACTTTCTTGCTTGAGG - Intronic
1074499148 10:114007020-114007042 CCAATCTACTTTCTCTCTACAGG - Intergenic
1077739686 11:4831747-4831769 ATAATCTACTATCACGCATGTGG - Intronic
1080321283 11:31012651-31012673 AAAATCTACTTTCCTGTTAGTGG - Intronic
1081738040 11:45418225-45418247 GTAAACTTCTTTCTCGCAAGGGG - Intergenic
1090434726 11:126677267-126677289 CTAATTTACTTTCTGGCTAATGG + Intronic
1093917438 12:24821235-24821257 AAAATCTATGTTCTCACTAGTGG - Intronic
1097334227 12:58364419-58364441 ATAATTTACTTTATGGCAAGTGG + Intergenic
1101218008 12:102604571-102604593 ATAATAAACTTTCTCTTTAGGGG - Intergenic
1105745953 13:23377097-23377119 CTAATCTACTTTCTGTCTATGGG - Intronic
1107383787 13:39886419-39886441 TTAATCTACTTGCTAGCTATAGG - Intergenic
1111777264 13:92680204-92680226 ATTATCTGCTTTGTCCCTAGAGG + Intronic
1117773738 14:59161079-59161101 ATAATCTACTTTCTCTTTAGTGG - Intergenic
1124972452 15:34501820-34501842 ATTATCTGTTTTCTCCCTAGAGG + Intergenic
1126317820 15:47389389-47389411 ACATTCTACTTTCTGCCTAGAGG + Intronic
1132187937 15:99819849-99819871 ATTATCTGCTTTGTCCCTAGAGG - Intergenic
1138754224 16:59463643-59463665 ACAATCAACTGTCTCTCTAGTGG + Intergenic
1139583847 16:67888516-67888538 AGAATCTGCTCTCTGGCTAGGGG + Intronic
1140640949 16:76972162-76972184 GTAATCTACTTTCTAGTTTGAGG - Intergenic
1142314310 16:89333907-89333929 ATAAACTACTTTCTCACCACTGG + Intronic
1144226049 17:13147938-13147960 ATGATCTACTTTCTCACCTGAGG - Intergenic
1144420076 17:15088483-15088505 ATAAACTATTTTCTAGCTGGTGG - Intergenic
1148285158 17:46382938-46382960 ATCATCTACTTTCTTATTAGAGG + Intergenic
1148307321 17:46600534-46600556 ATCATCTACTTTCTTATTAGAGG + Intronic
1160338383 18:78063824-78063846 AGAATCTACTTTGTCACTACTGG - Intergenic
1165989147 19:39796477-39796499 ACCATCTACTTTCTCTCTATAGG - Intergenic
1166255784 19:41603460-41603482 AGAATTTTCTTTCTCTCTAGCGG - Intronic
928927179 2:36592108-36592130 ACAAGCTACTTACTAGCTAGAGG + Intronic
932958280 2:76381997-76382019 ACAATCTGCTTTCTAGGTAGTGG - Intergenic
933400597 2:81792090-81792112 GAAATCTTCTTTCTCTCTAGTGG + Intergenic
937585291 2:123539939-123539961 ATAATTTACATTCTCACTAACGG + Intergenic
941255337 2:163222636-163222658 ATAATTTACATTCTGGCTATTGG + Intergenic
1170804894 20:19621032-19621054 ATCATCTATTTTCTCTTTAGTGG + Intronic
1175122126 20:56723953-56723975 ATAATATAATTTCTTGTTAGAGG + Intergenic
1176943772 21:14954586-14954608 ATAAGCTCCTTTCTAGCTTGAGG - Intergenic
950353105 3:12376565-12376587 ATCTTCTACTTCCTAGCTAGAGG + Intronic
951987486 3:28636786-28636808 ATAAGCCACTTTCTGGCTATTGG + Intergenic
954770886 3:52967378-52967400 ATAATCTACTTTCTGTCTCTAGG - Intronic
955095570 3:55794372-55794394 ATAATGGACTTTGTGGCTAGAGG + Intronic
955774992 3:62423356-62423378 ATAAGCCACGTTCTAGCTAGAGG + Intronic
955964379 3:64373111-64373133 CTAATCTACTTTCTGTCTACAGG - Intronic
959795611 3:110424522-110424544 ATAATCTGCCTTTTTGCTAGGGG - Intergenic
962047546 3:131776608-131776630 GTCATCTGCTTTATCGCTAGGGG - Intronic
972989297 4:44803868-44803890 ATAATCAACTTTCTATCAAGTGG - Intergenic
977413577 4:96699629-96699651 ATAATCTATGTTCACTCTAGTGG + Intergenic
979523222 4:121691801-121691823 ATAATTTATTTTCTCATTAGCGG - Intronic
981258994 4:142696897-142696919 TTTATCTACTTCCTTGCTAGAGG - Intronic
981651313 4:147062206-147062228 ATAACATACTTTCTAGCTAAGGG - Intergenic
983091945 4:163514446-163514468 ATATTCTTCTTTCTTGCTAGGGG - Intronic
983444085 4:167826436-167826458 ATAAGTTACTTCCTCTCTAGGGG - Intergenic
984697014 4:182789295-182789317 ATAATCTACTTTCTCGCTAGTGG - Exonic
985285857 4:188336005-188336027 TTAATCAACTTTCTGGCTACTGG + Intergenic
987810635 5:22830788-22830810 ATAATTTTCTTTCTCTCTAATGG - Intronic
990352456 5:54932287-54932309 ATAAACTACTTTTTCTCTATGGG + Intergenic
1000180493 5:158805633-158805655 AGAATCTACTTTTTTGTTAGAGG + Intronic
1000520333 5:162287111-162287133 ATATTCCCCTTTCTCTCTAGAGG + Intergenic
1000807721 5:165817404-165817426 ATAATTTACTTTCTCACATGTGG + Intergenic
1005901849 6:30223166-30223188 ATAATCTACATTCCCTTTAGTGG + Intergenic
1009624425 6:66121008-66121030 ATAATTTACATTCCCACTAGAGG + Intergenic
1012256962 6:97044678-97044700 ATAATCTCCTTACTTGCTATTGG + Intronic
1014941307 6:127442376-127442398 ATAATATGCTTTCCAGCTAGAGG - Exonic
1016791744 6:148073618-148073640 TTAATCTACTTTCTCACCATAGG - Intergenic
1023358420 7:39391078-39391100 ATAATGTATTTTTTAGCTAGTGG - Intronic
1031185168 7:118469737-118469759 ATAATCTATTGTCTTGCTTGTGG - Intergenic
1033637941 7:143229589-143229611 ATAATCTACTCTCCAGCTACTGG - Intergenic
1035847473 8:2880908-2880930 AGATTCTACTTTCTACCTAGAGG - Intergenic
1038564614 8:28609415-28609437 TTAATCTTCTTTATCGCTTGTGG - Intronic
1040631338 8:49216242-49216264 ATAATTTACATTCTCACCAGCGG + Intergenic
1046615719 8:116475011-116475033 ATCTTCTATTTTCTCTCTAGGGG - Intergenic
1051263634 9:15289864-15289886 ATCATCTGCTTTCTTGCAAGTGG + Intronic
1052478242 9:28989834-28989856 ATTCTCTACTTTCTGGCTGGTGG + Intergenic
1054958403 9:70939935-70939957 ATAAGCTACTTCCTAGCTAAAGG + Intronic
1062719669 9:138032509-138032531 ATAATTTACTTTCTGTTTAGGGG + Intronic
1187145829 X:16636481-16636503 CTAATCTACTTTCTGTCTATAGG - Intronic