ID: 984697019

View in Genome Browser
Species Human (GRCh38)
Location 4:182789310-182789332
Sequence TAGATTATGACGGACAGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984697013_984697019 3 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697014_984697019 -8 Left 984697014 4:182789295-182789317 CCACTAGCGAGAAAGTAGATTAT 0: 1
1: 0
2: 1
3: 1
4: 76
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697010_984697019 25 Left 984697010 4:182789262-182789284 CCACAGGTCAAATTGCCAGCATC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697012_984697019 10 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984697019 Original CRISPR TAGATTATGACGGACAGGGG AGG Exonic