ID: 984697019

View in Genome Browser
Species Human (GRCh38)
Location 4:182789310-182789332
Sequence TAGATTATGACGGACAGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984697013_984697019 3 Left 984697013 4:182789284-182789306 CCAGCGAGGCACCACTAGCGAGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697014_984697019 -8 Left 984697014 4:182789295-182789317 CCACTAGCGAGAAAGTAGATTAT 0: 1
1: 0
2: 1
3: 1
4: 76
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697010_984697019 25 Left 984697010 4:182789262-182789284 CCACAGGTCAAATTGCCAGCATC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
984697012_984697019 10 Left 984697012 4:182789277-182789299 CCAGCATCCAGCGAGGCACCACT 0: 1
1: 0
2: 2
3: 7
4: 98
Right 984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984697019 Original CRISPR TAGATTATGACGGACAGGGG AGG Exonic
903874307 1:26462309-26462331 TAGAATATGACGGCCAGGCATGG - Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905746936 1:40426182-40426204 AACATTATGAGGGCCAGGGGTGG - Intergenic
911168523 1:94746253-94746275 AAGATTTTGATGGAGAGGGGAGG - Intergenic
912012358 1:104983153-104983175 AAGATTATGACAGACACAGGTGG - Intergenic
914506567 1:148295086-148295108 TGGATTGTGACAGCCAGGGGGGG - Intergenic
916901024 1:169224041-169224063 TAGATGATGACAGATATGGGAGG - Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
1064586156 10:16841570-16841592 TAGATTAGAAAGGTCAGGGGTGG - Intronic
1068398909 10:56503076-56503098 TAGATTATGCTGAACAGGAGTGG + Intergenic
1072327378 10:94311732-94311754 TAGATGAGGACAGACAGAGGTGG - Intronic
1076387928 10:130071912-130071934 TAGAATATGACGGCCAGGCGCGG - Intergenic
1084142933 11:67245728-67245750 TAGATTAGAAAGGACCGGGGAGG + Intronic
1087008745 11:93493902-93493924 TAGAGAATGACAGAGAGGGGTGG - Intronic
1091239936 11:134045662-134045684 TAGATTATGTAGGACTTGGGGGG - Intergenic
1094484341 12:30912351-30912373 TAGATCATGAGGGTCAGGGTAGG - Intergenic
1105860457 13:24406088-24406110 GAGAGAATGAAGGACAGGGGTGG + Intergenic
1115642249 14:35342117-35342139 CACATTATGAGGGACAGCGGAGG - Intergenic
1119941606 14:78647287-78647309 TAGAACATGAAGGGCAGGGGCGG - Intronic
1120484419 14:85093455-85093477 TAGATTTTGTCAGGCAGGGGTGG - Intergenic
1129815304 15:78547448-78547470 TAGATTAAGAAGAACAGGAGAGG - Intronic
1138064292 16:53924595-53924617 TAGACTATGAAGGGCGGGGGAGG + Intronic
1139765731 16:69228216-69228238 TAGATTATGACCGGCCGCGGTGG + Intronic
1140145882 16:72308114-72308136 TAGATTTTGACAGACAGGCATGG - Intergenic
1161351019 19:3791730-3791752 CAGATTATGACAGCCAGAGGGGG - Intronic
927282103 2:21317928-21317950 TAGAGTCTGATGGACAGAGGAGG + Intergenic
932573504 2:72950591-72950613 TAGTTTTTGGTGGACAGGGGAGG - Intronic
934932921 2:98443117-98443139 TTGATTATGACTGCCAGGCGTGG + Intergenic
935718238 2:105957701-105957723 TAGATTATATTGGAAAGGGGAGG - Intergenic
938115248 2:128598055-128598077 AAAATTGTGATGGACAGGGGAGG + Intergenic
943904368 2:193478746-193478768 TACATTATGAGGATCAGGGGAGG + Intergenic
944752033 2:202718846-202718868 CAGAATTTGAAGGACAGGGGAGG - Intronic
946115103 2:217454316-217454338 CAGATTATGACAAAAAGGGGAGG - Intronic
947182458 2:227423600-227423622 TAGAGAATGACAGGCAGGGGTGG + Intergenic
1184512947 22:44943660-44943682 TAGATTTCGACGGACAGGTTTGG + Intronic
949616036 3:5754712-5754734 TTGTTTCTGAAGGACAGGGGAGG + Intergenic
950380374 3:12608673-12608695 TAGATTTTGACTGACAGGTCTGG - Intronic
950607586 3:14096453-14096475 TACATTATGACGGACCAGTGTGG + Intergenic
955460622 3:59179002-59179024 TAGATAATGAAGGCCAGGTGTGG + Intergenic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
959309827 3:104720506-104720528 TAGAATATCACAGACAGGCGAGG - Intergenic
963239326 3:142987566-142987588 TAGCTTCTGAGGGTCAGGGGTGG - Intronic
964025239 3:152065496-152065518 TAAATTATGGTGAACAGGGGTGG - Intergenic
966838189 3:184066029-184066051 TACACTATGACGGCCAGGCGCGG + Intergenic
970720580 4:18984037-18984059 TAGATTATAAAGCACAGGCGTGG + Intergenic
972637099 4:40893996-40894018 TAGATTATGAGGGCCGGGCGCGG + Intronic
977536785 4:98262601-98262623 GAAATTATGACAGACAGGAGTGG - Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
988270233 5:29004523-29004545 TAGATTCTGGGGGGCAGGGGTGG - Intergenic
989078022 5:37585785-37585807 GAGATTATGACAGGCAGGGCAGG - Intronic
996097723 5:119416575-119416597 TAGCTTATGACGGCCAGATGGGG + Intergenic
1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG + Intronic
1010606058 6:77890645-77890667 GAGATTATGAGGGGCTGGGGTGG + Intronic
1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG + Intronic
1022560660 7:31345838-31345860 TAAATTAGGAGGGCCAGGGGAGG - Intergenic
1037405786 8:18541058-18541080 TAGATTTTGATGGCCAGGGAAGG - Intronic
1061700013 9:132408909-132408931 TAGATTTTGAAGGGAAGGGGAGG - Intergenic
1189328778 X:40130148-40130170 TAGATGAAGAGGGACAGGGAAGG - Intronic
1196555290 X:117078210-117078232 TGGATTATCAGGGACAGAGGGGG + Intergenic
1200300288 X:154967482-154967504 TTGATTATGAGGAACAGGGAAGG + Intronic