ID: 984702138

View in Genome Browser
Species Human (GRCh38)
Location 4:182825356-182825378
Sequence ATTTCCCCCAGTGTGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984702131_984702138 -1 Left 984702131 4:182825334-182825356 CCATCCGCAAATGCCTGTGGACA No data
Right 984702138 4:182825356-182825378 ATTTCCCCCAGTGTGGGGTTGGG No data
984702132_984702138 -5 Left 984702132 4:182825338-182825360 CCGCAAATGCCTGTGGACATTTC No data
Right 984702138 4:182825356-182825378 ATTTCCCCCAGTGTGGGGTTGGG No data
984702129_984702138 20 Left 984702129 4:182825313-182825335 CCACGCACTGCTGAACAGTCACC No data
Right 984702138 4:182825356-182825378 ATTTCCCCCAGTGTGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984702138 Original CRISPR ATTTCCCCCAGTGTGGGGTT GGG Intergenic
No off target data available for this crispr