ID: 984703495

View in Genome Browser
Species Human (GRCh38)
Location 4:182833193-182833215
Sequence GAGGGGAGAGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984703495_984703508 17 Left 984703495 4:182833193-182833215 CCCTCCTCCTTCTCTCTCCCCTC No data
Right 984703508 4:182833233-182833255 TCCTTCTCCTCTCCCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984703495 Original CRISPR GAGGGGAGAGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr