ID: 984704066

View in Genome Browser
Species Human (GRCh38)
Location 4:182835097-182835119
Sequence AAGGCGCGTGCAGAACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984704066_984704073 13 Left 984704066 4:182835097-182835119 CCAGCGGGTTCTGCACGCGCCTT No data
Right 984704073 4:182835133-182835155 TCCACTGACATTTCTTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984704066 Original CRISPR AAGGCGCGTGCAGAACCCGC TGG (reversed) Intergenic
No off target data available for this crispr