ID: 984704073

View in Genome Browser
Species Human (GRCh38)
Location 4:182835133-182835155
Sequence TCCACTGACATTTCTTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984704063_984704073 27 Left 984704063 4:182835083-182835105 CCCCTCAGTCACTGCCAGCGGGT No data
Right 984704073 4:182835133-182835155 TCCACTGACATTTCTTCCCCCGG No data
984704066_984704073 13 Left 984704066 4:182835097-182835119 CCAGCGGGTTCTGCACGCGCCTT No data
Right 984704073 4:182835133-182835155 TCCACTGACATTTCTTCCCCCGG No data
984704065_984704073 25 Left 984704065 4:182835085-182835107 CCTCAGTCACTGCCAGCGGGTTC No data
Right 984704073 4:182835133-182835155 TCCACTGACATTTCTTCCCCCGG No data
984704070_984704073 -6 Left 984704070 4:182835116-182835138 CCTTGGAGTCCCGGGCATCCACT No data
Right 984704073 4:182835133-182835155 TCCACTGACATTTCTTCCCCCGG No data
984704064_984704073 26 Left 984704064 4:182835084-182835106 CCCTCAGTCACTGCCAGCGGGTT No data
Right 984704073 4:182835133-182835155 TCCACTGACATTTCTTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984704073 Original CRISPR TCCACTGACATTTCTTCCCC CGG Intergenic
No off target data available for this crispr