ID: 984704277

View in Genome Browser
Species Human (GRCh38)
Location 4:182836450-182836472
Sequence GGGAGTTCCCTGCTTAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984704277_984704282 -3 Left 984704277 4:182836450-182836472 CCTCTACTAAGCAGGGAACTCCC No data
Right 984704282 4:182836470-182836492 CCCCCAAATGCAGGGGTATCTGG No data
984704277_984704280 -10 Left 984704277 4:182836450-182836472 CCTCTACTAAGCAGGGAACTCCC No data
Right 984704280 4:182836463-182836485 GGGAACTCCCCCAAATGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984704277 Original CRISPR GGGAGTTCCCTGCTTAGTAG AGG (reversed) Intergenic
No off target data available for this crispr