ID: 984706666

View in Genome Browser
Species Human (GRCh38)
Location 4:182852155-182852177
Sequence CTTGTAAACCATCACGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984706666_984706670 9 Left 984706666 4:182852155-182852177 CCAGCGCCGTGATGGTTTACAAG No data
Right 984706670 4:182852187-182852209 CATCAGGAAGTCACCCTACATGG No data
984706666_984706669 -7 Left 984706666 4:182852155-182852177 CCAGCGCCGTGATGGTTTACAAG No data
Right 984706669 4:182852171-182852193 TTACAAGTCATGGCAACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984706666 Original CRISPR CTTGTAAACCATCACGGCGC TGG (reversed) Intergenic
No off target data available for this crispr