ID: 984709362

View in Genome Browser
Species Human (GRCh38)
Location 4:182872260-182872282
Sequence GCTGCTTTGCAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984709362_984709370 27 Left 984709362 4:182872260-182872282 CCTTCCTCCATCTGCAAAGCAGC No data
Right 984709370 4:182872310-182872332 CTCCTGCCTCTCTCTTGTAAGGG No data
984709362_984709366 3 Left 984709362 4:182872260-182872282 CCTTCCTCCATCTGCAAAGCAGC No data
Right 984709366 4:182872286-182872308 GCAGTGTAGCTCTCTGCCTCTGG No data
984709362_984709369 26 Left 984709362 4:182872260-182872282 CCTTCCTCCATCTGCAAAGCAGC No data
Right 984709369 4:182872309-182872331 CCTCCTGCCTCTCTCTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984709362 Original CRISPR GCTGCTTTGCAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr