ID: 984710660

View in Genome Browser
Species Human (GRCh38)
Location 4:182881353-182881375
Sequence GCAGCTACTACTGTCTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984710660_984710663 18 Left 984710660 4:182881353-182881375 CCTTTAAAGACAGTAGTAGCTGC No data
Right 984710663 4:182881394-182881416 TGAGCACTGATGTTCTGAGTCGG No data
984710660_984710665 28 Left 984710660 4:182881353-182881375 CCTTTAAAGACAGTAGTAGCTGC No data
Right 984710665 4:182881404-182881426 TGTTCTGAGTCGGTAGCAAAGGG No data
984710660_984710664 27 Left 984710660 4:182881353-182881375 CCTTTAAAGACAGTAGTAGCTGC No data
Right 984710664 4:182881403-182881425 ATGTTCTGAGTCGGTAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984710660 Original CRISPR GCAGCTACTACTGTCTTTAA AGG (reversed) Intergenic