ID: 984712293

View in Genome Browser
Species Human (GRCh38)
Location 4:182895858-182895880
Sequence GAATTTGTAAGCAATTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984712282_984712293 22 Left 984712282 4:182895813-182895835 CCCTGTGCCTGCAGAGTGTGATG 0: 1
1: 0
2: 1
3: 14
4: 217
Right 984712293 4:182895858-182895880 GAATTTGTAAGCAATTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 146
984712286_984712293 15 Left 984712286 4:182895820-182895842 CCTGCAGAGTGTGATGGCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 252
Right 984712293 4:182895858-182895880 GAATTTGTAAGCAATTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 146
984712283_984712293 21 Left 984712283 4:182895814-182895836 CCTGTGCCTGCAGAGTGTGATGG 0: 1
1: 0
2: 0
3: 11
4: 184
Right 984712293 4:182895858-182895880 GAATTTGTAAGCAATTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 146
984712291_984712293 -2 Left 984712291 4:182895837-182895859 CCTGGGCTGTGGCTTGGGCTTGA 0: 1
1: 0
2: 2
3: 34
4: 354
Right 984712293 4:182895858-182895880 GAATTTGTAAGCAATTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984712293 Original CRISPR GAATTTGTAAGCAATTCCCC GGG Intronic
900072448 1:782286-782308 GACATAGTAACCAATTCCCCTGG + Intergenic
900434468 1:2622190-2622212 GGATTTGTAACAATTTCCCCAGG + Intronic
900799090 1:4726633-4726655 GCATTTAAAACCAATTCCCCAGG - Intronic
901359672 1:8686313-8686335 GAATTTCTACGTAATTCCCTAGG - Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
908420851 1:63957099-63957121 GAACTTGTAGGCAGTTCTCCTGG + Intronic
909339691 1:74517888-74517910 GAATTTCTAACCAGTTCCCAGGG + Intronic
910769774 1:90819064-90819086 TAATTTGTAAGCAAAACACCAGG + Intergenic
913236502 1:116788981-116789003 AAAGTTGAAAGCATTTCCCCTGG + Intergenic
919244202 1:194956791-194956813 AAATTTATAATCAATTACCCTGG - Intergenic
920542804 1:206792150-206792172 GAATTTTTATGCTGTTCCCCAGG - Intergenic
921349019 1:214216730-214216752 GATTTTTTAAGCAATACCACAGG + Intergenic
922267389 1:223996245-223996267 GACATAGTAACCAATTCCCCTGG + Intergenic
1066691084 10:38028860-38028882 GAATGTGAAAGCAATCCCCATGG - Intronic
1066726324 10:38399358-38399380 GACATAGTAACCAATTCCCCTGG - Intergenic
1068567508 10:58592409-58592431 TAATTTTTAAGAAATTCCTCTGG + Intronic
1071402614 10:85290401-85290423 AAATTTGAAAGCATTTCCCCTGG + Intergenic
1073795957 10:106988794-106988816 GAATTTGTAATAAACTCCCAGGG + Intronic
1074125162 10:110523318-110523340 AAAAATATAAGCAATTCCCCTGG - Intergenic
1074374493 10:112928121-112928143 GCATTTGTAAGCAAGTCCATGGG - Intergenic
1075476671 10:122741351-122741373 GACATTGTAAGTAATTCCCACGG + Intergenic
1075577242 10:123586333-123586355 GAATGTGTCAGCATTTCCCTTGG + Intergenic
1075686844 10:124370333-124370355 GAATTTGTAATCATTTTGCCCGG - Intergenic
1076161337 10:128246467-128246489 GAATTTGTAAGACATTACCTGGG - Intergenic
1080044214 11:27791443-27791465 GAATTTGTAAGCAATAAACTTGG + Intergenic
1080156370 11:29116367-29116389 GCATTTGTAACAAATTCCCATGG - Intergenic
1080273234 11:30473138-30473160 CAATTTGTAAACCATTCCCTTGG + Intronic
1081430974 11:42976423-42976445 AAATTGTTGAGCAATTCCCCAGG + Intergenic
1086311632 11:85541833-85541855 GATTTTGTTAGCAATTCAACAGG - Intronic
1086605733 11:88693927-88693949 AAATTTGTAAGCAAGTCCTGAGG + Intronic
1087810434 11:102604308-102604330 GAATTGGTAAGCAATGACCCGGG - Intronic
1088983198 11:114882411-114882433 GAATTTTCAAGGAATTCACCAGG + Intergenic
1092039982 12:5375476-5375498 GAATTTGGAAGGATTTCCCCAGG + Intergenic
1093910451 12:24741454-24741476 GAAATTTTGAGCAATTACCCAGG + Intergenic
1096997488 12:55847903-55847925 GAATTTTTAAGCTGTTACCCTGG + Intergenic
1097354471 12:58586118-58586140 GAATTTGTAAAATTTTCCCCAGG + Intronic
1097647059 12:62249045-62249067 AAATTTTTAAACAATTACCCTGG - Intronic
1099115576 12:78620165-78620187 GAACTTGTAAGCAATGAACCTGG - Intergenic
1101021106 12:100554748-100554770 CAAATTTTAAGCAATTCTCCAGG + Intronic
1102203429 12:111074325-111074347 GAATCTGTAACTAAGTCCCCAGG + Intronic
1103381201 12:120495776-120495798 GAATTTGGAATCACTTCCCTTGG + Intronic
1105643636 13:22292506-22292528 TAATTTGAAAGGAATTCCCTGGG + Intergenic
1111039179 13:82722066-82722088 GAATTTGGAAGCCATTCCCATGG + Intergenic
1119673009 14:76533864-76533886 GAATATGAAAGCAAATTCCCAGG + Intergenic
1120195276 14:81475305-81475327 GAATTTGGAAGCAATTATCTGGG + Exonic
1120401388 14:84036897-84036919 GAATCTGCCAGCAGTTCCCCAGG - Intergenic
1120514363 14:85452757-85452779 CCATTTGTAATCAATTCCCTTGG - Intergenic
1121659110 14:95621409-95621431 GAATTGTTAAAAAATTCCCCAGG - Intergenic
1122831511 14:104399619-104399641 GGATGTGGAAGCAATGCCCCTGG + Intergenic
1125125734 15:36218425-36218447 GAATTTATGAGCAATTCACCAGG - Intergenic
1125552099 15:40552891-40552913 GGATTTGTAAACTATTACCCAGG + Intronic
1125557408 15:40597873-40597895 GAATTTGAAAATATTTCCCCTGG + Intronic
1127710360 15:61591245-61591267 GTATTTTTAAGCAGTTCCCCAGG + Intergenic
1130090710 15:80818923-80818945 GAGTTTGGAAGCCACTCCCCAGG - Intronic
1130128631 15:81116886-81116908 GAACTTGTAAACAATTCACAAGG + Intronic
1133146391 16:3790295-3790317 GAATTAATAAACAATTTCCCTGG - Intronic
1134464517 16:14463023-14463045 TAATGGGTGAGCAATTCCCCAGG + Intronic
1134660980 16:15984354-15984376 GTATTTGTAAGAAATTCCAGAGG + Intronic
1135736399 16:24935012-24935034 GAGTTTTAAAGCAATTCCCCTGG + Intronic
1138039582 16:53648270-53648292 GAATTTAAATGCAATTCCTCAGG - Intronic
1141475538 16:84270672-84270694 GAGTTTGTCAGCAACTCCACTGG + Intergenic
1141938375 16:87257179-87257201 GAAATTATAAGCATTTCCCCAGG - Intronic
1145028275 17:19485770-19485792 CAATTTGGAAGCACTCCCCCGGG - Intergenic
1148882130 17:50736990-50737012 GTATTTGTGAACAATTCCGCAGG - Exonic
1153496012 18:5700390-5700412 GAATATGTGAGTAATTTCCCGGG + Intergenic
1159153861 18:64556557-64556579 GAATGTGTAAACAGTTACCCTGG + Intergenic
927680217 2:25134010-25134032 GTATTTGTAACAAGTTCCCCAGG + Intronic
928148249 2:28802766-28802788 GAATTTCTAAATAAATCCCCTGG + Exonic
928595417 2:32855283-32855305 GAAGTTGTAAGCAACCCCTCAGG + Intergenic
929322731 2:40565115-40565137 GATTTTTTACCCAATTCCCCTGG + Intronic
929759199 2:44792063-44792085 GAATCTGTAAACAATTCCTGAGG + Intergenic
930052126 2:47224591-47224613 GAATTTGTAAGTGAATCACCCGG + Intergenic
931580630 2:63768577-63768599 TATTTTCTAAGAAATTCCCCAGG + Intronic
937138081 2:119572697-119572719 GGATTTGTCATCACTTCCCCAGG - Intronic
937808232 2:126170421-126170443 GAAATTGTGAGCATTTGCCCTGG - Intergenic
938577772 2:132620160-132620182 GTGCTTGTAAGCAACTCCCCAGG + Intronic
941377538 2:164750410-164750432 CAATCTGTTAACAATTCCCCTGG + Intronic
942393462 2:175521157-175521179 TACTTTGTAAGCATTTCTCCAGG + Intergenic
942932598 2:181513669-181513691 GTATTTTTCACCAATTCCCCAGG + Intronic
945505828 2:210638993-210639015 GAATTAGAAAGCAATTCCACGGG + Intronic
946189574 2:218001291-218001313 AATTTTGTATCCAATTCCCCAGG - Intronic
946856496 2:223955549-223955571 GAATATATAAGCAATATCCCTGG + Intergenic
1173825279 20:46044052-46044074 GACTTTGCAAGCAATCCCCGTGG - Intronic
1176920099 21:14678137-14678159 GAGTTTTGTAGCAATTCCCCAGG - Intergenic
1180906849 22:19419548-19419570 TAATATGTAAGAAATTCCCGAGG - Intronic
951419890 3:22471786-22471808 GAAATTGGAAGCTATTCCACTGG - Intergenic
951981738 3:28574941-28574963 GAAGTTGTAAGCTACTACCCAGG + Intergenic
953843813 3:46410892-46410914 GCATTTCTAACAAATTCCCCAGG + Intronic
955224454 3:57049598-57049620 GCATTTCTGAGCAATTCCCCAGG - Intronic
956267784 3:67416938-67416960 GAATTTATAACCAATTCCTGTGG + Intronic
957159568 3:76592283-76592305 TACTTTTTAACCAATTCCCCTGG + Intronic
957341282 3:78900243-78900265 GAATTTATTAAGAATTCCCCTGG - Intronic
960901121 3:122555444-122555466 TAATTTGAAAGAAATTCACCTGG - Exonic
962610393 3:137071293-137071315 GAATTTGCAAGCAGTTCCCAGGG - Intergenic
965143725 3:164870600-164870622 GCAATTCTAAGCAATTCTCCCGG - Intergenic
966149043 3:176846184-176846206 GAATTTGTAAACAGTTCACTTGG + Intergenic
969193410 4:5542292-5542314 TAATTTTTAAGAAATTACCCAGG + Intergenic
969872777 4:10115321-10115343 GAATTTGCAAGGATTTCCCAAGG + Intronic
972603538 4:40593462-40593484 GATTTTCTAAGCGATTCCCTTGG - Intronic
974238654 4:59213997-59214019 GAAATTGTAAGGAATTCTCAGGG + Intergenic
976692791 4:87886424-87886446 GAATTTGTTACCTATTCTCCCGG - Intergenic
979335660 4:119458317-119458339 GACATAGTAACCAATTCCCCTGG + Intergenic
979726487 4:123968794-123968816 GAATTTGCAAACACTTACCCAGG - Intergenic
980125962 4:128774428-128774450 GCATTTGTAACAAGTTCCCCAGG + Intergenic
980563180 4:134503080-134503102 GTATTTTCAAGCAATTACCCTGG - Intergenic
982365823 4:154577168-154577190 TAATTTGTAAGTAATTACACTGG + Intergenic
983126255 4:163954710-163954732 GAATTTGTAACAAGATCCCCAGG - Intronic
984712293 4:182895858-182895880 GAATTTGTAAGCAATTCCCCGGG + Intronic
985308360 4:188569678-188569700 GAATTTCTAAGCATTTTACCTGG + Intergenic
985501438 5:249842-249864 GAATTTCCAAACAATTCCCAGGG + Intronic
985735443 5:1577793-1577815 GAATTTCCAAACAATTCCCAGGG - Intergenic
989999959 5:50881009-50881031 CTATTTGAAAGCAATTGCCCTGG - Intergenic
990790961 5:59479158-59479180 GTATTTTTAAGAAACTCCCCAGG - Intronic
994814728 5:104570562-104570584 GAAATTGTCAGACATTCCCCTGG - Intergenic
995624966 5:114066428-114066450 GAATCTGAGAGCAATTCCCTTGG + Intergenic
996282775 5:121751377-121751399 GAATTTGATAATAATTCCCCAGG + Intergenic
996450319 5:123614415-123614437 GAACATGTAAGTAACTCCCCAGG - Exonic
997839792 5:137228933-137228955 GAATTTGTTAGAACTTACCCTGG + Intronic
1000158741 5:158578303-158578325 AAAGTTGAAAGCATTTCCCCTGG - Intergenic
1000264856 5:159625812-159625834 AAAGTTGAAAGCATTTCCCCTGG + Intergenic
1000574405 5:162958904-162958926 GAATGTGGAACCAATCCCCCAGG + Intergenic
1001739932 5:174044705-174044727 GAATCTGTGAGCAATCCCCGGGG + Intergenic
1004775214 6:18836540-18836562 GAATCTGTAAGGAATTCCTTTGG - Intergenic
1004817486 6:19328302-19328324 GTATATGTATGGAATTCCCCAGG + Intergenic
1012897618 6:104968703-104968725 GCTTTTGTAAGCAATTTCCTAGG + Intronic
1014834231 6:126141932-126141954 GAAATTGGAAGCACTTTCCCTGG - Intergenic
1016082412 6:139872027-139872049 GAGTTTGTAAGCAATTCAAGGGG + Intergenic
1020242630 7:6407717-6407739 GAAGTTGGAAGCAGTTCCCTAGG + Intergenic
1021963426 7:25894787-25894809 GAATTTGTTCACAATTTCCCTGG + Intergenic
1022667328 7:32423939-32423961 GCATTTGTTAGAAATTCCTCTGG - Intergenic
1023005665 7:35863895-35863917 GACATAGTAACCAATTCCCCTGG + Intronic
1023578342 7:41654015-41654037 GAAATTGTGACCAATGCCCCTGG - Intergenic
1024068432 7:45765440-45765462 GACATAGTAACCAATTCCCCTGG - Intergenic
1026646836 7:72178119-72178141 AAATTTGTAAGCAATTCAGAAGG + Intronic
1035492427 7:159291841-159291863 GGATTTTTAAACAATTCCCTGGG - Intergenic
1036285702 8:7442767-7442789 GAAAATGTGAGCAATGCCCCAGG + Intronic
1036335771 8:7868762-7868784 GAAAATGTGAGCAATGCCCCAGG - Intronic
1036827509 8:11989063-11989085 GAATGTGTAATGAATTTCCCAGG - Intergenic
1043565336 8:81541506-81541528 AAGTTTCTGAGCAATTCCCCTGG + Intergenic
1043795869 8:84538173-84538195 GAAATAGAAAGCAAATCCCCCGG - Intronic
1044675912 8:94728360-94728382 GAACTGGAAAACAATTCCCCAGG - Intronic
1046244050 8:111535100-111535122 TAAATTATTAGCAATTCCCCAGG - Intergenic
1048683448 8:136873537-136873559 GACTTTGAAAGCCAGTCCCCAGG + Intergenic
1053432420 9:38051810-38051832 GAATGTGTAAGGAATTGTCCAGG + Intronic
1057942533 9:99297480-99297502 GGATGTGAAAGCACTTCCCCAGG - Intergenic
1059378843 9:113907721-113907743 GAATGTCTAACCAACTCCCCAGG + Intronic
1187097004 X:16159658-16159680 GAATATGTAAGCCATTCTCATGG + Intergenic
1187305980 X:18095645-18095667 GCATTTTTAATAAATTCCCCAGG - Intergenic
1187720942 X:22150247-22150269 GCATTTTTAACCAAGTCCCCAGG - Intronic
1187757452 X:22543495-22543517 GAATTTGTAACAAGTTCTCCAGG + Intergenic
1187771269 X:22699579-22699601 GAATTGGTATGCAACTCCCCTGG - Intergenic
1188137765 X:26510756-26510778 GAATTGGTAACCCATACCCCAGG + Intergenic
1188788202 X:34374951-34374973 GATTTTTTGAGCAATACCCCAGG + Intergenic
1191222989 X:58010674-58010696 GAAATTGAAAGCATTCCCCCTGG - Intergenic
1192268036 X:69553685-69553707 GAATTTCTAAGAATGTCCCCAGG + Intergenic
1193147962 X:78096858-78096880 GAATTTTAAAGCACATCCCCAGG + Intronic
1193500349 X:82266621-82266643 GAATTTCTCAGAAATTCCTCAGG - Intergenic
1196967240 X:121070034-121070056 AAATTTTTAATCAATTCCACTGG + Intergenic
1199242102 X:145559319-145559341 AAAGTTGAAAGCATTTCCCCTGG + Intergenic