ID: 984712997

View in Genome Browser
Species Human (GRCh38)
Location 4:182901855-182901877
Sequence AGCACTCAGGCCCTAACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984712997_984713001 -10 Left 984712997 4:182901855-182901877 CCTGAAGTTAGGGCCTGAGTGCT 0: 1
1: 0
2: 0
3: 14
4: 162
Right 984713001 4:182901868-182901890 CCTGAGTGCTTTTACTTCTGGGG 0: 1
1: 1
2: 2
3: 22
4: 219
984712997_984713003 20 Left 984712997 4:182901855-182901877 CCTGAAGTTAGGGCCTGAGTGCT 0: 1
1: 0
2: 0
3: 14
4: 162
Right 984713003 4:182901898-182901920 GTTATCAGAGTTGCTAAACCTGG 0: 1
1: 0
2: 1
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984712997 Original CRISPR AGCACTCAGGCCCTAACTTC AGG (reversed) Intronic