ID: 984712997 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:182901855-182901877 |
| Sequence | AGCACTCAGGCCCTAACTTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 177 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 14, 4: 162} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984712997_984713001 | -10 | Left | 984712997 | 4:182901855-182901877 | CCTGAAGTTAGGGCCTGAGTGCT | 0: 1 1: 0 2: 0 3: 14 4: 162 |
||
| Right | 984713001 | 4:182901868-182901890 | CCTGAGTGCTTTTACTTCTGGGG | 0: 1 1: 1 2: 2 3: 22 4: 219 |
||||
| 984712997_984713003 | 20 | Left | 984712997 | 4:182901855-182901877 | CCTGAAGTTAGGGCCTGAGTGCT | 0: 1 1: 0 2: 0 3: 14 4: 162 |
||
| Right | 984713003 | 4:182901898-182901920 | GTTATCAGAGTTGCTAAACCTGG | 0: 1 1: 0 2: 1 3: 6 4: 67 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984712997 | Original CRISPR | AGCACTCAGGCCCTAACTTC AGG (reversed) | Intronic | ||