ID: 984715117

View in Genome Browser
Species Human (GRCh38)
Location 4:182917644-182917666
Sequence CCACGCGTGACCCGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984715117_984715127 8 Left 984715117 4:182917644-182917666 CCCGCTGCCCGGGTCACGCGTGG 0: 1
1: 0
2: 1
3: 5
4: 72
Right 984715127 4:182917675-182917697 GGCCGCGAGTTGGGCGCTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 87
984715117_984715128 9 Left 984715117 4:182917644-182917666 CCCGCTGCCCGGGTCACGCGTGG 0: 1
1: 0
2: 1
3: 5
4: 72
Right 984715128 4:182917676-182917698 GCCGCGAGTTGGGCGCTCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 53
984715117_984715125 -2 Left 984715117 4:182917644-182917666 CCCGCTGCCCGGGTCACGCGTGG 0: 1
1: 0
2: 1
3: 5
4: 72
Right 984715125 4:182917665-182917687 GGCGCTGGGTGGCCGCGAGTTGG No data
984715117_984715126 -1 Left 984715117 4:182917644-182917666 CCCGCTGCCCGGGTCACGCGTGG 0: 1
1: 0
2: 1
3: 5
4: 72
Right 984715126 4:182917666-182917688 GCGCTGGGTGGCCGCGAGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 77
984715117_984715133 30 Left 984715117 4:182917644-182917666 CCCGCTGCCCGGGTCACGCGTGG 0: 1
1: 0
2: 1
3: 5
4: 72
Right 984715133 4:182917697-182917719 GGCCTGACTGCACGACCGTCGGG 0: 1
1: 0
2: 0
3: 6
4: 50
984715117_984715132 29 Left 984715117 4:182917644-182917666 CCCGCTGCCCGGGTCACGCGTGG 0: 1
1: 0
2: 1
3: 5
4: 72
Right 984715132 4:182917696-182917718 GGGCCTGACTGCACGACCGTCGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984715117 Original CRISPR CCACGCGTGACCCGGGCAGC GGG (reversed) Intronic