ID: 984716144

View in Genome Browser
Species Human (GRCh38)
Location 4:182927097-182927119
Sequence ACAAAAAATTAGCTGGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984716144_984716150 17 Left 984716144 4:182927097-182927119 CCAATCCCCAGCTAATTTTTTGT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data
984716144_984716148 -2 Left 984716144 4:182927097-182927119 CCAATCCCCAGCTAATTTTTTGT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data
984716144_984716149 -1 Left 984716144 4:182927097-182927119 CCAATCCCCAGCTAATTTTTTGT No data
Right 984716149 4:182927119-182927141 TATTTTTTTAAGTACAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984716144 Original CRISPR ACAAAAAATTAGCTGGGGAT TGG (reversed) Intergenic