ID: 984716145

View in Genome Browser
Species Human (GRCh38)
Location 4:182927102-182927124
Sequence AAAATACAAAAAATTAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984716145_984716149 -6 Left 984716145 4:182927102-182927124 CCCCAGCTAATTTTTTGTATTTT No data
Right 984716149 4:182927119-182927141 TATTTTTTTAAGTACAGACAGGG No data
984716145_984716148 -7 Left 984716145 4:182927102-182927124 CCCCAGCTAATTTTTTGTATTTT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data
984716145_984716150 12 Left 984716145 4:182927102-182927124 CCCCAGCTAATTTTTTGTATTTT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984716145 Original CRISPR AAAATACAAAAAATTAGCTG GGG (reversed) Intergenic