ID: 984716146

View in Genome Browser
Species Human (GRCh38)
Location 4:182927103-182927125
Sequence AAAAATACAAAAAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984716146_984716150 11 Left 984716146 4:182927103-182927125 CCCAGCTAATTTTTTGTATTTTT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data
984716146_984716148 -8 Left 984716146 4:182927103-182927125 CCCAGCTAATTTTTTGTATTTTT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data
984716146_984716149 -7 Left 984716146 4:182927103-182927125 CCCAGCTAATTTTTTGTATTTTT No data
Right 984716149 4:182927119-182927141 TATTTTTTTAAGTACAGACAGGG No data
984716146_984716153 30 Left 984716146 4:182927103-182927125 CCCAGCTAATTTTTTGTATTTTT No data
Right 984716153 4:182927156-182927178 CAGGCTAGTCTTGAACTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984716146 Original CRISPR AAAAATACAAAAAATTAGCT GGG (reversed) Intergenic