ID: 984716147

View in Genome Browser
Species Human (GRCh38)
Location 4:182927104-182927126
Sequence AAAAAATACAAAAAATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984716147_984716153 29 Left 984716147 4:182927104-182927126 CCAGCTAATTTTTTGTATTTTTT No data
Right 984716153 4:182927156-182927178 CAGGCTAGTCTTGAACTCCTAGG No data
984716147_984716150 10 Left 984716147 4:182927104-182927126 CCAGCTAATTTTTTGTATTTTTT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data
984716147_984716149 -8 Left 984716147 4:182927104-182927126 CCAGCTAATTTTTTGTATTTTTT No data
Right 984716149 4:182927119-182927141 TATTTTTTTAAGTACAGACAGGG No data
984716147_984716148 -9 Left 984716147 4:182927104-182927126 CCAGCTAATTTTTTGTATTTTTT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984716147 Original CRISPR AAAAAATACAAAAAATTAGC TGG (reversed) Intergenic