ID: 984716148

View in Genome Browser
Species Human (GRCh38)
Location 4:182927118-182927140
Sequence GTATTTTTTTAAGTACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984716144_984716148 -2 Left 984716144 4:182927097-182927119 CCAATCCCCAGCTAATTTTTTGT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data
984716146_984716148 -8 Left 984716146 4:182927103-182927125 CCCAGCTAATTTTTTGTATTTTT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data
984716147_984716148 -9 Left 984716147 4:182927104-182927126 CCAGCTAATTTTTTGTATTTTTT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data
984716143_984716148 6 Left 984716143 4:182927089-182927111 CCGGGTCTCCAATCCCCAGCTAA No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data
984716145_984716148 -7 Left 984716145 4:182927102-182927124 CCCCAGCTAATTTTTTGTATTTT No data
Right 984716148 4:182927118-182927140 GTATTTTTTTAAGTACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984716148 Original CRISPR GTATTTTTTTAAGTACAGAC AGG Intergenic