ID: 984716150

View in Genome Browser
Species Human (GRCh38)
Location 4:182927137-182927159
Sequence CAGGGTTTCACATGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984716145_984716150 12 Left 984716145 4:182927102-182927124 CCCCAGCTAATTTTTTGTATTTT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data
984716146_984716150 11 Left 984716146 4:182927103-182927125 CCCAGCTAATTTTTTGTATTTTT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data
984716144_984716150 17 Left 984716144 4:182927097-182927119 CCAATCCCCAGCTAATTTTTTGT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data
984716147_984716150 10 Left 984716147 4:182927104-182927126 CCAGCTAATTTTTTGTATTTTTT No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data
984716143_984716150 25 Left 984716143 4:182927089-182927111 CCGGGTCTCCAATCCCCAGCTAA No data
Right 984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984716150 Original CRISPR CAGGGTTTCACATGTTGCCC AGG Intergenic