ID: 984716153

View in Genome Browser
Species Human (GRCh38)
Location 4:182927156-182927178
Sequence CAGGCTAGTCTTGAACTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984716146_984716153 30 Left 984716146 4:182927103-182927125 CCCAGCTAATTTTTTGTATTTTT No data
Right 984716153 4:182927156-182927178 CAGGCTAGTCTTGAACTCCTAGG No data
984716147_984716153 29 Left 984716147 4:182927104-182927126 CCAGCTAATTTTTTGTATTTTTT No data
Right 984716153 4:182927156-182927178 CAGGCTAGTCTTGAACTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984716153 Original CRISPR CAGGCTAGTCTTGAACTCCT AGG Intergenic