ID: 984718945

View in Genome Browser
Species Human (GRCh38)
Location 4:182952543-182952565
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984718945_984718953 12 Left 984718945 4:182952543-182952565 CCTTACCCACAGGGGCCTAAGTA No data
Right 984718953 4:182952578-182952600 ACAATGGCATTCCTAGGAGCTGG No data
984718945_984718952 6 Left 984718945 4:182952543-182952565 CCTTACCCACAGGGGCCTAAGTA No data
Right 984718952 4:182952572-182952594 TAATACACAATGGCATTCCTAGG No data
984718945_984718951 -4 Left 984718945 4:182952543-182952565 CCTTACCCACAGGGGCCTAAGTA No data
Right 984718951 4:182952562-182952584 AGTAGAGGGCTAATACACAATGG No data
984718945_984718954 13 Left 984718945 4:182952543-182952565 CCTTACCCACAGGGGCCTAAGTA No data
Right 984718954 4:182952579-182952601 CAATGGCATTCCTAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984718945 Original CRISPR TACTTAGGCCCCTGTGGGTA AGG (reversed) Intergenic