ID: 984718947

View in Genome Browser
Species Human (GRCh38)
Location 4:182952548-182952570
Sequence CCCTCTACTTAGGCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984718947_984718954 8 Left 984718947 4:182952548-182952570 CCCACAGGGGCCTAAGTAGAGGG No data
Right 984718954 4:182952579-182952601 CAATGGCATTCCTAGGAGCTGGG No data
984718947_984718953 7 Left 984718947 4:182952548-182952570 CCCACAGGGGCCTAAGTAGAGGG No data
Right 984718953 4:182952578-182952600 ACAATGGCATTCCTAGGAGCTGG No data
984718947_984718956 27 Left 984718947 4:182952548-182952570 CCCACAGGGGCCTAAGTAGAGGG No data
Right 984718956 4:182952598-182952620 TGGGTGCGTGTGCAACCAATAGG No data
984718947_984718957 28 Left 984718947 4:182952548-182952570 CCCACAGGGGCCTAAGTAGAGGG No data
Right 984718957 4:182952599-182952621 GGGTGCGTGTGCAACCAATAGGG No data
984718947_984718952 1 Left 984718947 4:182952548-182952570 CCCACAGGGGCCTAAGTAGAGGG No data
Right 984718952 4:182952572-182952594 TAATACACAATGGCATTCCTAGG No data
984718947_984718951 -9 Left 984718947 4:182952548-182952570 CCCACAGGGGCCTAAGTAGAGGG No data
Right 984718951 4:182952562-182952584 AGTAGAGGGCTAATACACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984718947 Original CRISPR CCCTCTACTTAGGCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr