ID: 984718949

View in Genome Browser
Species Human (GRCh38)
Location 4:182952549-182952571
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984718949_984718957 27 Left 984718949 4:182952549-182952571 CCACAGGGGCCTAAGTAGAGGGC No data
Right 984718957 4:182952599-182952621 GGGTGCGTGTGCAACCAATAGGG No data
984718949_984718954 7 Left 984718949 4:182952549-182952571 CCACAGGGGCCTAAGTAGAGGGC No data
Right 984718954 4:182952579-182952601 CAATGGCATTCCTAGGAGCTGGG No data
984718949_984718952 0 Left 984718949 4:182952549-182952571 CCACAGGGGCCTAAGTAGAGGGC No data
Right 984718952 4:182952572-182952594 TAATACACAATGGCATTCCTAGG No data
984718949_984718956 26 Left 984718949 4:182952549-182952571 CCACAGGGGCCTAAGTAGAGGGC No data
Right 984718956 4:182952598-182952620 TGGGTGCGTGTGCAACCAATAGG No data
984718949_984718953 6 Left 984718949 4:182952549-182952571 CCACAGGGGCCTAAGTAGAGGGC No data
Right 984718953 4:182952578-182952600 ACAATGGCATTCCTAGGAGCTGG No data
984718949_984718951 -10 Left 984718949 4:182952549-182952571 CCACAGGGGCCTAAGTAGAGGGC No data
Right 984718951 4:182952562-182952584 AGTAGAGGGCTAATACACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984718949 Original CRISPR GCCCTCTACTTAGGCCCCTG TGG (reversed) Intergenic