ID: 984718950

View in Genome Browser
Species Human (GRCh38)
Location 4:182952558-182952580
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984718950_984718956 17 Left 984718950 4:182952558-182952580 CCTAAGTAGAGGGCTAATACACA No data
Right 984718956 4:182952598-182952620 TGGGTGCGTGTGCAACCAATAGG No data
984718950_984718954 -2 Left 984718950 4:182952558-182952580 CCTAAGTAGAGGGCTAATACACA No data
Right 984718954 4:182952579-182952601 CAATGGCATTCCTAGGAGCTGGG No data
984718950_984718957 18 Left 984718950 4:182952558-182952580 CCTAAGTAGAGGGCTAATACACA No data
Right 984718957 4:182952599-182952621 GGGTGCGTGTGCAACCAATAGGG No data
984718950_984718952 -9 Left 984718950 4:182952558-182952580 CCTAAGTAGAGGGCTAATACACA No data
Right 984718952 4:182952572-182952594 TAATACACAATGGCATTCCTAGG No data
984718950_984718953 -3 Left 984718950 4:182952558-182952580 CCTAAGTAGAGGGCTAATACACA No data
Right 984718953 4:182952578-182952600 ACAATGGCATTCCTAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984718950 Original CRISPR TGTGTATTAGCCCTCTACTT AGG (reversed) Intergenic