ID: 984718956 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:182952598-182952620 |
Sequence | TGGGTGCGTGTGCAACCAAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
984718950_984718956 | 17 | Left | 984718950 | 4:182952558-182952580 | CCTAAGTAGAGGGCTAATACACA | No data | ||
Right | 984718956 | 4:182952598-182952620 | TGGGTGCGTGTGCAACCAATAGG | No data | ||||
984718949_984718956 | 26 | Left | 984718949 | 4:182952549-182952571 | CCACAGGGGCCTAAGTAGAGGGC | No data | ||
Right | 984718956 | 4:182952598-182952620 | TGGGTGCGTGTGCAACCAATAGG | No data | ||||
984718947_984718956 | 27 | Left | 984718947 | 4:182952548-182952570 | CCCACAGGGGCCTAAGTAGAGGG | No data | ||
Right | 984718956 | 4:182952598-182952620 | TGGGTGCGTGTGCAACCAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
984718956 | Original CRISPR | TGGGTGCGTGTGCAACCAAT AGG | Intergenic | ||