ID: 984718957

View in Genome Browser
Species Human (GRCh38)
Location 4:182952599-182952621
Sequence GGGTGCGTGTGCAACCAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984718950_984718957 18 Left 984718950 4:182952558-182952580 CCTAAGTAGAGGGCTAATACACA No data
Right 984718957 4:182952599-182952621 GGGTGCGTGTGCAACCAATAGGG No data
984718947_984718957 28 Left 984718947 4:182952548-182952570 CCCACAGGGGCCTAAGTAGAGGG No data
Right 984718957 4:182952599-182952621 GGGTGCGTGTGCAACCAATAGGG No data
984718949_984718957 27 Left 984718949 4:182952549-182952571 CCACAGGGGCCTAAGTAGAGGGC No data
Right 984718957 4:182952599-182952621 GGGTGCGTGTGCAACCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984718957 Original CRISPR GGGTGCGTGTGCAACCAATA GGG Intergenic
No off target data available for this crispr