ID: 984720619

View in Genome Browser
Species Human (GRCh38)
Location 4:182969773-182969795
Sequence GAAGATTAAGTGGAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984720619_984720624 6 Left 984720619 4:182969773-182969795 CCATGCTCCTCCACTTAATCTTC No data
Right 984720624 4:182969802-182969824 CCTGCCACACCCGCCTTCTAGGG No data
984720619_984720625 7 Left 984720619 4:182969773-182969795 CCATGCTCCTCCACTTAATCTTC No data
Right 984720625 4:182969803-182969825 CTGCCACACCCGCCTTCTAGGGG No data
984720619_984720631 28 Left 984720619 4:182969773-182969795 CCATGCTCCTCCACTTAATCTTC No data
Right 984720631 4:182969824-182969846 GGATGGCTCCTTCCTCATCTTGG No data
984720619_984720627 11 Left 984720619 4:182969773-182969795 CCATGCTCCTCCACTTAATCTTC No data
Right 984720627 4:182969807-182969829 CACACCCGCCTTCTAGGGGATGG No data
984720619_984720622 5 Left 984720619 4:182969773-182969795 CCATGCTCCTCCACTTAATCTTC No data
Right 984720622 4:182969801-182969823 TCCTGCCACACCCGCCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984720619 Original CRISPR GAAGATTAAGTGGAGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr