ID: 984722159

View in Genome Browser
Species Human (GRCh38)
Location 4:182983572-182983594
Sequence AAGTGCCAAGGTAATCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984722154_984722159 23 Left 984722154 4:182983526-182983548 CCAAAAATAAGCCCACATGTAAA No data
Right 984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG No data
984722156_984722159 11 Left 984722156 4:182983538-182983560 CCACATGTAAAAAAGATCAGCTA No data
Right 984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG No data
984722155_984722159 12 Left 984722155 4:182983537-182983559 CCCACATGTAAAAAAGATCAGCT No data
Right 984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984722159 Original CRISPR AAGTGCCAAGGTAATCAAAT GGG Intergenic
No off target data available for this crispr