ID: 984731616

View in Genome Browser
Species Human (GRCh38)
Location 4:183073770-183073792
Sequence TGTCCCAGGTAAAACCCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984731609_984731616 13 Left 984731609 4:183073734-183073756 CCACCAGGTGGCAGCATGATCTC No data
Right 984731616 4:183073770-183073792 TGTCCCAGGTAAAACCCGGATGG No data
984731610_984731616 10 Left 984731610 4:183073737-183073759 CCAGGTGGCAGCATGATCTCGTG No data
Right 984731616 4:183073770-183073792 TGTCCCAGGTAAAACCCGGATGG No data
984731607_984731616 23 Left 984731607 4:183073724-183073746 CCCATGTGGACCACCAGGTGGCA No data
Right 984731616 4:183073770-183073792 TGTCCCAGGTAAAACCCGGATGG No data
984731608_984731616 22 Left 984731608 4:183073725-183073747 CCATGTGGACCACCAGGTGGCAG No data
Right 984731616 4:183073770-183073792 TGTCCCAGGTAAAACCCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984731616 Original CRISPR TGTCCCAGGTAAAACCCGGA TGG Intergenic
No off target data available for this crispr