ID: 984734404

View in Genome Browser
Species Human (GRCh38)
Location 4:183097674-183097696
Sequence GCATCTGCGGCCAATCTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734404_984734410 -4 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
984734404_984734408 -10 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734404_984734409 -5 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734404_984734417 22 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
984734404_984734411 -3 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734404 Original CRISPR GCATCTGCGGCCAATCTCGA AGG (reversed) Intergenic
1067908619 10:50320797-50320819 GCCTCTGAGCCCAATCTCAAAGG - Intronic
1072545133 10:96431557-96431579 GTACCTGCGGCCAATGTCAATGG - Intronic
1083484392 11:62974336-62974358 GCATCTGAGGCCACTCTGGTGGG + Intronic
1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG + Exonic
1107039808 13:35936804-35936826 GCATCTGAGGCCAATAGGGAGGG + Intronic
1118287094 14:64485205-64485227 GCATCAGCGTCCAATCAGGAGGG - Exonic
1137524359 16:49221302-49221324 GCTTCTGAGGCTAATCTCAATGG - Intergenic
1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG + Intronic
928441594 2:31296770-31296792 CCATCTGGGGCCAGTCTCGGAGG + Intergenic
1172175096 20:32967420-32967442 GCACCTGAGGCAAATCTCCAGGG - Intergenic
1184324678 22:43774379-43774401 GGGTCTGCAGCCAATCTCCATGG - Intronic
1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG + Intronic
949942125 3:9163244-9163266 GCATCAGCGCCCACTCTCGTGGG + Intronic
957730187 3:84125138-84125160 GCAGCAGCGGCCCATCTGGAGGG + Intergenic
962920100 3:139942952-139942974 GCATCTCTGGCCAATCTCTGGGG - Intronic
964990499 3:162805081-162805103 GTATCTGATGCCAATCTAGAGGG - Intergenic
984068166 4:175076352-175076374 ACATCTGAGGACAATCACGATGG - Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG + Intronic
1005084663 6:21992757-21992779 GAATCTGTGGTCAATCTCAAAGG - Intergenic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1049414457 8:142488924-142488946 GCATCTGCCGCCCATCTTCAAGG - Intronic
1061875169 9:133539938-133539960 GCACCTGGGACCAAACTCGACGG + Intronic
1196942016 X:120786383-120786405 ACATCTTTGGCTAATCTCGAAGG - Intergenic