ID: 984734408

View in Genome Browser
Species Human (GRCh38)
Location 4:183097687-183097709
Sequence CCGCAGATGCCCCGACGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734395_984734408 28 Left 984734395 4:183097636-183097658 CCCTTCCGTGAAGTCTGTTCCAA 0: 1
1: 0
2: 0
3: 3
4: 99
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734394_984734408 29 Left 984734394 4:183097635-183097657 CCCCTTCCGTGAAGTCTGTTCCA 0: 1
1: 0
2: 2
3: 10
4: 147
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734403_984734408 -7 Left 984734403 4:183097671-183097693 CCACCTTCGAGATTGGCCGCAGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734402_984734408 -2 Left 984734402 4:183097666-183097688 CCTCTCCACCTTCGAGATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734400_984734408 4 Left 984734400 4:183097660-183097682 CCTGAGCCTCTCCACCTTCGAGA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734398_984734408 9 Left 984734398 4:183097655-183097677 CCAACCCTGAGCCTCTCCACCTT 0: 1
1: 0
2: 1
3: 45
4: 453
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734399_984734408 5 Left 984734399 4:183097659-183097681 CCCTGAGCCTCTCCACCTTCGAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734396_984734408 27 Left 984734396 4:183097637-183097659 CCTTCCGTGAAGTCTGTTCCAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734397_984734408 23 Left 984734397 4:183097641-183097663 CCGTGAAGTCTGTTCCAACCCTG 0: 1
1: 0
2: 1
3: 16
4: 211
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734404_984734408 -10 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734408 Original CRISPR CCGCAGATGCCCCGACGGGA TGG Intergenic
900464279 1:2816890-2816912 CCAACGATGCCACGACGGGAAGG + Intergenic
900572641 1:3366312-3366334 GCGCTGATGTCCTGACGGGAAGG + Intronic
902628805 1:17692615-17692637 CCGCAGCTGCCCAGGTGGGAAGG - Intronic
904488327 1:30842446-30842468 CCTCAGATGCCCCCACAGGCTGG + Intergenic
916742389 1:167657613-167657635 GCACAGATGCCCAGAGGGGAGGG - Intronic
1063973566 10:11397841-11397863 CAGAAAATGCCCCGATGGGAAGG + Intergenic
1081109805 11:39121069-39121091 CCGCAGATGCCCAGAAGGGCTGG - Intergenic
1083658639 11:64242005-64242027 CTGCAGTTGCCCCGACTGGGCGG - Exonic
1096178612 12:49538900-49538922 CCGCCGAGGTCCCGAAGGGAGGG + Intergenic
1103972129 12:124678905-124678927 CCCCAGATGACCCCAGGGGAGGG - Intergenic
1105307871 13:19181700-19181722 CCGCAGACGCCCAGGCTGGAGGG - Intronic
1114292618 14:21301102-21301124 CCCCAGATGCACCGACTGCAAGG + Exonic
1123010589 14:105347825-105347847 CGGCAGATGCCCCGGGGAGATGG + Intronic
1124139756 15:27067160-27067182 CCCCAGATGCTCCCACTGGAGGG - Intronic
1128994413 15:72286267-72286289 CCGCAGCTGCTCCTTCGGGAAGG + Exonic
1132016302 15:98320467-98320489 CGGCAGATGCACCGATGGGTGGG - Intergenic
1139848897 16:69939092-69939114 CGGCAAATCCCCCGACGGGCAGG - Exonic
1142390460 16:89796359-89796381 CCGCTGAGGCCCCGTCGGGTTGG - Intronic
1148693864 17:49547782-49547804 CCACAGAGGCCCGGATGGGAGGG + Intergenic
1148845479 17:50527441-50527463 CTGCAGATGCCACAAAGGGAAGG - Intronic
1153734525 18:8051101-8051123 CCACAGATACCCCCACGGGATGG - Intronic
1154913257 18:20686313-20686335 CCGCAGATTCCACGAAGAGACGG - Intergenic
1154915525 18:20720969-20720991 CCGCAGATTCCACGAAGAGACGG - Intergenic
1154922071 18:20822107-20822129 CCGCAGATTCCACGAAGAGACGG + Intergenic
1155002822 18:21703916-21703938 TCGCCAATGCCCCGAGGGGAAGG + Intronic
1162604212 19:11694585-11694607 CCGCAGTCGCCGCGAAGGGACGG + Intergenic
1167349141 19:48963981-48964003 CTGCAGATGCCCCGCCAGGCCGG - Intergenic
1168340806 19:55622034-55622056 CCGCAGATGCCGCAATGGTATGG + Exonic
927645517 2:24874581-24874603 CCACAGAAGCCCAGCCGGGAAGG - Intronic
928084786 2:28339218-28339240 CTGCAGAGGCCCAGAGGGGATGG - Intergenic
1176194834 20:63832066-63832088 CCGCAGACAACACGACGGGAGGG - Intergenic
1180131030 21:45827191-45827213 CAGCTGATGCCCAGATGGGAAGG - Intronic
1180199670 21:46216636-46216658 CCGCAGATGCACTGACGTGGTGG - Intronic
1183238936 22:36641246-36641268 CCGCAGAGCCCACGAGGGGAAGG + Intronic
1185256911 22:49838947-49838969 CTGCAGATTCCCCTATGGGAGGG - Intergenic
954567042 3:51607981-51608003 CCGCAGCTGCCCCGCCCGGGAGG - Intronic
968674553 4:1870820-1870842 CCGCAGAGGCCCCGCCGTGGCGG - Intergenic
969330730 4:6472342-6472364 CCGCCGGGGCCCCGAAGGGAGGG + Intronic
984734408 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG + Intergenic
987054555 5:14179043-14179065 CCGCAGAAGCCGGGACTGGAGGG + Intronic
988997375 5:36727306-36727328 CTGCAGATGGCCTGACGGGTGGG - Intergenic
995040561 5:107583586-107583608 ACGCAGATGCTCCAAAGGGATGG - Intronic
997694451 5:135850345-135850367 CCGGAGATGCCCAGAGGGAAAGG - Intronic
998366768 5:141637232-141637254 CCTCAGATGCCCCGACCGAGCGG - Exonic
1001779394 5:174354825-174354847 CCACAGATGCCCAGACATGAGGG + Intergenic
1002921695 6:1577493-1577515 GCACAGCTGCCCCGACGGGTGGG - Intergenic
1005685707 6:28251651-28251673 CTGCAGATTCCCCGGCAGGATGG + Exonic
1005696902 6:28359873-28359895 CTGCAGATTCCCCGGCAGGATGG - Exonic
1012352850 6:98274881-98274903 CAGCAGATGCCCCCAGGTGAAGG - Intergenic
1017010043 6:150057534-150057556 CCGCGGATGTCCCACCGGGAGGG + Intergenic
1017618762 6:156273444-156273466 CCCCAGATGACCTGATGGGAGGG - Intergenic
1018722154 6:166581302-166581324 CCGCATAGGCCCTGAGGGGAAGG - Intronic
1018837498 6:167496327-167496349 ACGCAGCTGCCCCGGCTGGATGG - Intergenic
1019558047 7:1642247-1642269 CCGCAGAAGCCCCTATGGGACGG + Intergenic
1019716267 7:2540885-2540907 CCGCAGAGGCCTGCACGGGACGG + Intronic
1020099780 7:5388480-5388502 CCGCGGATGCCCCCACGGTGCGG - Exonic
1020131693 7:5562524-5562546 CTACAGGTGCCCCGGCGGGAAGG + Intronic
1042857823 8:73285618-73285640 CCGCAGCTGCACCGAGGGGAGGG + Intergenic
1043530156 8:81140679-81140701 CCTCAGTTGCCCAGACTGGAGGG - Intergenic
1056932801 9:90892788-90892810 CGGCAGAGGCCCCCACTGGAGGG - Intronic
1057869627 9:98708378-98708400 CCCCCGAAGCCCCGACGGCAGGG + Intronic
1060918430 9:127404662-127404684 CCGCAGAAGCCCTGACTGGGTGG - Intronic
1192669659 X:73126774-73126796 CCGCAGATCCCCTGAAGGGGTGG + Exonic
1198364371 X:135925958-135925980 CCATAGATGCTCCGAGGGGAGGG - Intergenic