ID: 984734409

View in Genome Browser
Species Human (GRCh38)
Location 4:183097692-183097714
Sequence GATGCCCCGACGGGATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734404_984734409 -5 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734398_984734409 14 Left 984734398 4:183097655-183097677 CCAACCCTGAGCCTCTCCACCTT 0: 1
1: 0
2: 1
3: 45
4: 453
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734400_984734409 9 Left 984734400 4:183097660-183097682 CCTGAGCCTCTCCACCTTCGAGA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734399_984734409 10 Left 984734399 4:183097659-183097681 CCCTGAGCCTCTCCACCTTCGAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734403_984734409 -2 Left 984734403 4:183097671-183097693 CCACCTTCGAGATTGGCCGCAGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734402_984734409 3 Left 984734402 4:183097666-183097688 CCTCTCCACCTTCGAGATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
984734397_984734409 28 Left 984734397 4:183097641-183097663 CCGTGAAGTCTGTTCCAACCCTG 0: 1
1: 0
2: 1
3: 16
4: 211
Right 984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734409 Original CRISPR GATGCCCCGACGGGATGGCC TGG Intergenic
901680966 1:10912663-10912685 AATGCCCCGAGGGCAGGGCCAGG - Intergenic
901763453 1:11485355-11485377 GATGCCCCGAGCAGATGGCTGGG - Intronic
905393133 1:37650870-37650892 GATGCCCATACTGGAGGGCCAGG + Intergenic
910865371 1:91783429-91783451 GGTGCCCCGGCGGGCTGGACAGG + Intronic
911569703 1:99508040-99508062 GCTTCCCAGACGGGGTGGCCGGG - Intergenic
915342425 1:155183967-155183989 GATGCCCAGGCGGGGTGGCAGGG - Exonic
1064679542 10:17796129-17796151 GATGTCCCGGCGAGATGTCCGGG + Exonic
1067054458 10:43042847-43042869 GGTGCCCCGACTGGCTGGCCTGG + Intergenic
1067334219 10:45347697-45347719 GCTTCCCAGACGGGGTGGCCAGG - Intergenic
1069550358 10:69360063-69360085 GCTGGCCCGACGGGGTGACCCGG - Intronic
1076555859 10:131321046-131321068 GCTGCTCCGAGGGGCTGGCCTGG + Intergenic
1076643137 10:131932267-131932289 GATGTCTCCATGGGATGGCCAGG + Intronic
1076693577 10:132236364-132236386 GGTGACCCGATGGGGTGGCCAGG + Intronic
1077155895 11:1090654-1090676 GATGCCCCTCTGGGAAGGCCGGG - Intergenic
1079303056 11:19296622-19296644 GATGCCCTGGAGGCATGGCCTGG + Intergenic
1089351641 11:117824746-117824768 GCTGCCTCCACGGGGTGGCCGGG + Intronic
1104012164 12:124939641-124939663 GATTCCCCGACGGGGAGGCCGGG - Intergenic
1104115481 12:125745408-125745430 GATGCCTCGACGGGAGTGTCAGG + Intergenic
1112777602 13:102862371-102862393 GATGTGCAGACGGGAGGGCCAGG + Exonic
1119480786 14:74956292-74956314 GCTGCCCCGCAGGGAGGGCCTGG - Intergenic
1122482628 14:102056916-102056938 GATGGAAGGACGGGATGGCCAGG - Intergenic
1123050454 14:105538886-105538908 GAGGCCCCGACAGCCTGGCCCGG + Intergenic
1132915537 16:2341521-2341543 GGTCACCCGACGGGATGGTCCGG + Intergenic
1133283868 16:4681624-4681646 GAGGGGCCGAGGGGATGGCCGGG - Exonic
1134861090 16:17561262-17561284 GATGCCCCGACCGGATGAACCGG - Intergenic
1144478775 17:15611991-15612013 GAGGACCCGAGGGGAGGGCCAGG - Intronic
1144919527 17:18751742-18751764 GAGGACCCGAGGGGAGGGCCAGG + Intronic
1145903394 17:28502200-28502222 GAGGCCCTGATGGGATGCCCAGG - Intronic
1150220052 17:63491075-63491097 GAGGCCCCGCCGGGATGGGAGGG + Intronic
1152537463 17:80959135-80959157 GCTGCCCACACGGGAAGGCCTGG - Intronic
1152601427 17:81264159-81264181 TCTGCACAGACGGGATGGCCGGG + Intronic
1153681148 18:7502114-7502136 GATGACCCGGCTGGATGGTCTGG + Intergenic
1157404041 18:47408822-47408844 GATGCCCCCACTGGATGTACAGG + Intergenic
1161767392 19:6215130-6215152 GAAGCTCCGACGGTGTGGCCTGG + Intronic
1163719712 19:18893390-18893412 GGGGCCCTGAGGGGATGGCCGGG - Intronic
1164911821 19:32018962-32018984 GGTGCCCCCAGGGGATGGCGAGG + Intergenic
1168247020 19:55117522-55117544 GATGTCCGGAGAGGATGGCCCGG - Exonic
1168402268 19:56092361-56092383 GAGGTCCCGAGGGGATGGGCTGG + Intronic
929313618 2:40452293-40452315 TTTGCCCCGACGCGATCGCCTGG - Intronic
929652271 2:43692120-43692142 GAGACCCAGACTGGATGGCCTGG - Intronic
1185069976 22:48650848-48650870 GATGCCCTGGCGGGCTGGCCAGG + Intronic
954395632 3:50291963-50291985 GAGGCCCGGAGGGGCTGGCCGGG + Intronic
955069122 3:55557518-55557540 GATTCCCCCAAGGGGTGGCCAGG - Intronic
962152463 3:132907452-132907474 GATGCCCCGAAGAGGAGGCCAGG - Intergenic
967894345 3:194384381-194384403 GAGGCCCGGAGGGGATGCCCTGG + Intergenic
969054244 4:4391657-4391679 GATGCCCTGCAGGGAGGGCCAGG + Intronic
984734409 4:183097692-183097714 GATGCCCCGACGGGATGGCCTGG + Intergenic
985111907 4:186555206-186555228 GATACACCGACAGGATGACCAGG + Exonic
1002915260 6:1523740-1523762 GCTGCCCCGAAGTGATGTCCTGG + Intergenic
1005685708 6:28251656-28251678 GATTCCCCGGCAGGATGGTCAGG + Exonic
1005696901 6:28359868-28359890 GATTCCCCGGCAGGATGGTCAGG - Exonic
1008106271 6:47443912-47443934 ACTTCCCAGACGGGATGGCCAGG + Intergenic
1008572066 6:52825664-52825686 ACTTCCCAGACGGGATGGCCGGG - Intergenic
1035034150 7:155884414-155884436 GACGCCCAGAGTGGATGGCCAGG - Intergenic
1035461380 7:159041225-159041247 GCTGCCCCACCGGGAGGGCCTGG - Intronic
1036789630 8:11709131-11709153 GAGGCCCCGGCGGGCAGGCCCGG - Intronic
1049102518 8:140589735-140589757 GATGCCAGGACAGGATGCCCTGG + Intronic
1049838282 8:144754345-144754367 GCTGCCCCGTGGGCATGGCCTGG - Intronic
1057274485 9:93669144-93669166 GTTGCCCAGACGGCATGGCATGG + Intronic
1187901887 X:24033488-24033510 GATGGCCGGGCAGGATGGCCGGG + Intergenic
1189332387 X:40152008-40152030 GCTGCGCCGACGAGAAGGCCTGG + Intronic
1189421637 X:40862445-40862467 GCTTCCCAGACGGGGTGGCCGGG - Intergenic
1192505078 X:71676438-71676460 ACTTCCCCGACGGGGTGGCCAGG - Intergenic
1201411405 Y:13702877-13702899 GTTGCCAGGACGGGATGGGCAGG - Intergenic