ID: 984734410

View in Genome Browser
Species Human (GRCh38)
Location 4:183097693-183097715
Sequence ATGCCCCGACGGGATGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734398_984734410 15 Left 984734398 4:183097655-183097677 CCAACCCTGAGCCTCTCCACCTT 0: 1
1: 0
2: 1
3: 45
4: 453
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
984734397_984734410 29 Left 984734397 4:183097641-183097663 CCGTGAAGTCTGTTCCAACCCTG 0: 1
1: 0
2: 1
3: 16
4: 211
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
984734404_984734410 -4 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
984734400_984734410 10 Left 984734400 4:183097660-183097682 CCTGAGCCTCTCCACCTTCGAGA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
984734402_984734410 4 Left 984734402 4:183097666-183097688 CCTCTCCACCTTCGAGATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
984734399_984734410 11 Left 984734399 4:183097659-183097681 CCCTGAGCCTCTCCACCTTCGAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
984734403_984734410 -1 Left 984734403 4:183097671-183097693 CCACCTTCGAGATTGGCCGCAGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734410 Original CRISPR ATGCCCCGACGGGATGGCCT GGG Intergenic
900337589 1:2172289-2172311 TTGCCCCCACAGGAAGGCCTGGG + Exonic
905206102 1:36343645-36343667 ATGCCCCGCTGGCAGGGCCTGGG + Intronic
907556153 1:55345738-55345760 ATGCCCAGAAAGGATGGCTTGGG - Intergenic
920720381 1:208381473-208381495 ATGACCCCACAGGAGGGCCTGGG - Intergenic
923204417 1:231744232-231744254 ATGGCCCGAGGTGATGGCTTGGG + Intronic
1065006888 10:21388396-21388418 GTGCCCCGAGGGGATGGACCAGG + Intergenic
1067054459 10:43042848-43042870 GTGCCCCGACTGGCTGGCCTGGG + Intergenic
1076555860 10:131321047-131321069 CTGCTCCGAGGGGCTGGCCTGGG + Intergenic
1076661658 10:132059585-132059607 ATGCCCTGAGGGGTCGGCCTCGG - Intergenic
1078645758 11:13140388-13140410 ATGGTCCCAGGGGATGGCCTAGG - Intergenic
1079303057 11:19296623-19296645 ATGCCCTGGAGGCATGGCCTGGG + Intergenic
1080641849 11:34162885-34162907 CTGCCCCGACGGGCTGCTCTGGG + Intronic
1082271121 11:50170326-50170348 AGGACCCGACGGGCTGGCCGTGG - Intergenic
1086757111 11:90578547-90578569 ATGTCCTGAAGGCATGGCCTAGG + Intergenic
1098284089 12:68890741-68890763 ATGTCCCGGTGGGGTGGCCTCGG - Intronic
1110219761 13:73059813-73059835 CTGCCCCGGCGGGTCGGCCTGGG + Intronic
1113672234 13:112183092-112183114 AGGCCCGGACTGGATGGCTTTGG - Intergenic
1116948423 14:50857252-50857274 AGTCACCGACTGGATGGCCTTGG + Intergenic
1119480785 14:74956291-74956313 CTGCCCCGCAGGGAGGGCCTGGG - Intergenic
1124336522 15:28861384-28861406 CTGACCCCACGTGATGGCCTGGG + Intergenic
1126124259 15:45280836-45280858 ATGGCCGGACGCGGTGGCCTTGG - Intergenic
1148048688 17:44759000-44759022 CCGCCCCGCCGGGATGGCCGCGG + Intergenic
1152537462 17:80959134-80959156 CTGCCCACACGGGAAGGCCTGGG - Intronic
1153681149 18:7502115-7502137 ATGACCCGGCTGGATGGTCTGGG + Intergenic
1160730839 19:640984-641006 ATGGCCAGGCGGGGTGGCCTCGG + Intronic
1161767393 19:6215131-6215153 AAGCTCCGACGGTGTGGCCTGGG + Intronic
1166411125 19:42555891-42555913 AGGCCCCCACAGGAAGGCCTGGG + Intronic
1168402269 19:56092362-56092384 AGGTCCCGAGGGGATGGGCTGGG + Intronic
925064967 2:922489-922511 CTGCCCCAACGGGCTGCCCTTGG + Intergenic
929313617 2:40452292-40452314 TTGCCCCGACGCGATCGCCTGGG - Intronic
1173476118 20:43361037-43361059 ATGCCCCCACTGCAGGGCCTTGG + Intergenic
954417187 3:50399080-50399102 ATGCCAGGAGGGGAGGGCCTTGG + Intronic
956633882 3:71344037-71344059 GTGCCCAGATGGGAAGGCCTTGG - Intronic
967894346 3:194384382-194384404 AGGCCCGGAGGGGATGCCCTGGG + Intergenic
969677255 4:8620959-8620981 ATGCCCTGAGGCGAAGGCCTCGG + Intergenic
969678207 4:8626597-8626619 ATGCCCTGAGGCGAAGGCCTCGG + Intergenic
969679163 4:8632235-8632257 ATGCCCTGAGGCGAAGGCCTCGG + Intergenic
984734410 4:183097693-183097715 ATGCCCCGACGGGATGGCCTGGG + Intergenic
985727734 5:1524583-1524605 AGGCCCCGCAGGGATGGCCCAGG + Intergenic
1002099642 5:176851006-176851028 ATGCCCCCATGGGGTGGCCCAGG - Intronic
1004444561 6:15686156-15686178 ATCCTCCAGCGGGATGGCCTAGG + Intergenic
1013038457 6:106409932-106409954 ATGTCCCGATGGTATTGCCTAGG - Intergenic
1032076158 7:128837164-128837186 CTGCCCCGACTGGGAGGCCTGGG + Exonic
1032707601 7:134434643-134434665 AGGCCACGAGTGGATGGCCTGGG + Intergenic
1032861113 7:135880349-135880371 ATGCCACGAGGGCAGGGCCTTGG - Intergenic
1040838652 8:51759867-51759889 GTGCCCCGAGGGCATTGCCTTGG - Intronic
1041440582 8:57891834-57891856 GTGCCCTGACGGGAAGGCCACGG + Intergenic
1049838281 8:144754344-144754366 CTGCCCCGTGGGCATGGCCTGGG - Intronic
1187268051 X:17755431-17755453 CTGCCCCGGTGGGATGCCCTTGG + Intergenic
1187321199 X:18238852-18238874 CTGCCCCGGTGGGATGCCCTTGG - Intergenic
1188438458 X:30189727-30189749 ATGCCAAGAGGGGTTGGCCTTGG + Intergenic
1194775633 X:97960424-97960446 ATGTCCAGAGGGGAAGGCCTGGG + Intergenic