ID: 984734411

View in Genome Browser
Species Human (GRCh38)
Location 4:183097694-183097716
Sequence TGCCCCGACGGGATGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734400_984734411 11 Left 984734400 4:183097660-183097682 CCTGAGCCTCTCCACCTTCGAGA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78
984734399_984734411 12 Left 984734399 4:183097659-183097681 CCCTGAGCCTCTCCACCTTCGAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78
984734402_984734411 5 Left 984734402 4:183097666-183097688 CCTCTCCACCTTCGAGATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78
984734404_984734411 -3 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78
984734403_984734411 0 Left 984734403 4:183097671-183097693 CCACCTTCGAGATTGGCCGCAGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78
984734398_984734411 16 Left 984734398 4:183097655-183097677 CCAACCCTGAGCCTCTCCACCTT 0: 1
1: 0
2: 1
3: 45
4: 453
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78
984734397_984734411 30 Left 984734397 4:183097641-183097663 CCGTGAAGTCTGTTCCAACCCTG 0: 1
1: 0
2: 1
3: 16
4: 211
Right 984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734411 Original CRISPR TGCCCCGACGGGATGGCCTG GGG Intergenic
900364596 1:2305927-2305949 TGACCCCACGGGGTGGGCTGAGG + Intronic
900494710 1:2971219-2971241 TGCCCCCACAGGAGGGGCTGGGG - Intergenic
902984800 1:20148876-20148898 TGATCCCACAGGATGGCCTGGGG + Exonic
915489384 1:156242864-156242886 TGCCTCTCCGGGATGGTCTGTGG + Intronic
920191278 1:204195758-204195780 TGCCCCGATGGGCTGGGCAGTGG - Intronic
920720380 1:208381472-208381494 TGACCCCACAGGAGGGCCTGGGG - Intergenic
1063661139 10:8035854-8035876 TGCCCAGACGTGCTGGGCTGGGG - Intergenic
1067089340 10:43258679-43258701 TGCTCCTAGGGGCTGGCCTGTGG - Intronic
1074151668 10:110764779-110764801 TGGCACGACGGGCTGACCTGCGG - Intronic
1076555861 10:131321048-131321070 TGCTCCGAGGGGCTGGCCTGGGG + Intergenic
1076693579 10:132236366-132236388 TGACCCGATGGGGTGGCCAGGGG + Intronic
1076729627 10:132431941-132431963 TGCCCAGCAGGGATAGCCTGGGG + Intergenic
1079303058 11:19296624-19296646 TGCCCTGGAGGCATGGCCTGGGG + Intergenic
1080641850 11:34162886-34162908 TGCCCCGACGGGCTGCTCTGGGG + Intronic
1081465459 11:43312320-43312342 CACCCCGACGAGACGGCCTGAGG - Intronic
1084693230 11:70738976-70738998 TGGCCCGACGGAAGGACCTGTGG + Intronic
1096515335 12:52152412-52152434 TGCCCGGACACGTTGGCCTGCGG + Intergenic
1096689382 12:53310074-53310096 TGGCCAGGCTGGATGGCCTGTGG - Intronic
1101743557 12:107520709-107520731 TGCCCTGAGGGGTTGGCATGAGG - Intronic
1101969025 12:109299851-109299873 TGCCCCGCTGGGATGGGCTTAGG - Intronic
1117315160 14:54566195-54566217 CGCCCCGACGGCATGGCCCGCGG + Intergenic
1122116740 14:99531366-99531388 TGCCCAGCCGGGCTGGGCTGGGG - Intronic
1122143453 14:99675641-99675663 CCCGCCGGCGGGATGGCCTGGGG - Exonic
1122917243 14:104864972-104864994 TGCCGAGACGGGAGGGCATGGGG + Intergenic
1124336523 15:28861385-28861407 TGACCCCACGTGATGGCCTGGGG + Intergenic
1124370855 15:29103903-29103925 GGCGCCGCCGGGCTGGCCTGCGG - Intronic
1129599756 15:76991900-76991922 TGCCCCCACAGCCTGGCCTGAGG + Intergenic
1130651617 15:85765143-85765165 TGCCCAGCCCGGCTGGCCTGGGG + Intronic
1132915539 16:2341523-2341545 TCACCCGACGGGATGGTCCGGGG + Intergenic
1135537997 16:23309236-23309258 TGCCCCCACCTGAGGGCCTGGGG + Intronic
1136588110 16:31200975-31200997 TTCCCCCACGGGATGGGGTGGGG + Intergenic
1139673982 16:68510304-68510326 TGCCTCGACGCGGTGGCCCGTGG - Intergenic
1139971362 16:70777652-70777674 TGCCCTGACTGGAGGTCCTGTGG + Intronic
1144236204 17:13262785-13262807 TGCTCAGAAGGGCTGGCCTGAGG - Intergenic
1144493097 17:15731486-15731508 GACCCCCAGGGGATGGCCTGTGG + Intergenic
1144848968 17:18234491-18234513 TTCCCCGAGGGGGTGGTCTGGGG + Intronic
1144907158 17:18645166-18645188 GACCCCCAGGGGATGGCCTGTGG - Intronic
1145812285 17:27771595-27771617 TGCCACGATGGGATGAGCTGTGG - Intronic
1151490561 17:74430579-74430601 TGCCCTCACGGGCTGGTCTGGGG - Intronic
1152551919 17:81034517-81034539 TGCCCCGAGGGGCCGGCCGGGGG + Intergenic
1152566637 17:81103277-81103299 TCCCCCGACTGCATGGCTTGTGG + Intronic
1152938602 17:83154272-83154294 GGCCGTGACGGGAAGGCCTGAGG - Intergenic
1162398525 19:10431516-10431538 TGGCCAGACGGGGTGGGCTGCGG + Intronic
1162567890 19:11454161-11454183 ACCCCCGATGGGATGGCTTGGGG - Exonic
1163678059 19:18665451-18665473 TGTCCTGAGGGGATGCCCTGAGG - Intronic
1164911823 19:32018964-32018986 TGCCCCCAGGGGATGGCGAGGGG + Intergenic
1166283198 19:41808822-41808844 GGCCCCCACAGGAAGGCCTGGGG - Exonic
1166411126 19:42555892-42555914 GGCCCCCACAGGAAGGCCTGGGG + Intronic
1168402270 19:56092363-56092385 GGTCCCGAGGGGATGGGCTGGGG + Intronic
925064968 2:922490-922512 TGCCCCAACGGGCTGCCCTTGGG + Intergenic
929313616 2:40452291-40452313 TGCCCCGACGCGATCGCCTGGGG - Intronic
932625937 2:73295920-73295942 TGGCCCGACGGGGCGACCTGGGG - Intergenic
945452050 2:210005129-210005151 TGCCCCTACGTGATGTGCTGTGG + Intronic
946074360 2:217061741-217061763 TGCCCCACAGAGATGGCCTGTGG + Intergenic
946422521 2:219572547-219572569 TGCCCCGAAGACATGCCCTGGGG + Exonic
948585578 2:239016769-239016791 TGCCCCGAGGGGACATCCTGAGG - Intergenic
948863781 2:240765369-240765391 TGCCCTGTCGGGCTGGTCTGGGG - Intronic
948900335 2:240953531-240953553 AGCACAGACGGGCTGGCCTGTGG + Intronic
1174052023 20:47773531-47773553 TGCCCAGAAGGCATGGGCTGGGG - Intronic
1175950904 20:62582492-62582514 AGCCCCGACGGGAGAGACTGTGG + Intergenic
1179932307 21:44578910-44578932 TGCCCCCAGAGGAGGGCCTGGGG + Intronic
1183201159 22:36386966-36386988 CGCCCAGACGGGATGGCCCCTGG + Intronic
953906140 3:46869121-46869143 TCCCCCCACAGCATGGCCTGTGG + Intronic
954802548 3:53195531-53195553 TGCCCTCACGAGCTGGCCTGTGG - Intergenic
957775962 3:84757329-84757351 TGCTCCCACTGGATGGCCTCTGG - Intergenic
984734411 4:183097694-183097716 TGCCCCGACGGGATGGCCTGGGG + Intergenic
997964169 5:138344919-138344941 TTCCCCGACTGGGTGGTCTGAGG - Exonic
998254441 5:140573905-140573927 GGGCCCGCCGGGCTGGCCTGAGG - Intronic
1006370284 6:33640124-33640146 TGCCCTGATGGGATGGGCAGTGG - Intronic
1006677739 6:35776518-35776540 TCCTCCGCCGGGGTGGCCTGGGG + Intergenic
1008005112 6:46402327-46402349 TACCCCGAAGGGAAGGCCTCTGG + Intronic
1014741817 6:125154822-125154844 CGCCCAGAAGGGATGGCTTGCGG + Intronic
1019423654 7:963191-963213 TGCCCAGTCAGGAAGGCCTGGGG + Intronic
1019599601 7:1874722-1874744 TGCCCAGGCGGGAGGGCCTGTGG - Intronic
1032387458 7:131534420-131534442 TGCCCCGCCAGGATGGGGTGCGG - Intronic
1032707602 7:134434644-134434666 GGCCACGAGTGGATGGCCTGGGG + Intergenic
1035182147 7:157097296-157097318 TTCCCAGACGGGCTGGCCAGGGG - Intergenic
1040447186 8:47507348-47507370 TGCCCAGAAGAGATGGCATGAGG - Intronic
1049259326 8:141630315-141630337 AGCCCTGAAGGGCTGGCCTGAGG - Intergenic
1049748629 8:144273418-144273440 TGCCCCGTGGTGCTGGCCTGGGG - Intronic
1053409141 9:37904263-37904285 TGCCCCGCCGCGGCGGCCTGCGG - Intronic
1061874638 9:133537566-133537588 GGCCCTGAGGGGATGGCATGAGG + Intronic
1186122009 X:6373516-6373538 TGCCCCGGTGGGAAGGCCTCAGG + Intergenic
1201790273 Y:17832270-17832292 CGCCCCGCCTGGCTGGCCTGCGG - Intergenic
1201811281 Y:18073719-18073741 CGCCCCGCCTGGCTGGCCTGCGG + Intergenic