ID: 984734417

View in Genome Browser
Species Human (GRCh38)
Location 4:183097719-183097741
Sequence CCGAAAGCTGTCCCCAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734413_984734417 -1 Left 984734413 4:183097697-183097719 CCCGACGGGATGGCCTGGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
984734412_984734417 0 Left 984734412 4:183097696-183097718 CCCCGACGGGATGGCCTGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 89
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
984734402_984734417 30 Left 984734402 4:183097666-183097688 CCTCTCCACCTTCGAGATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
984734407_984734417 9 Left 984734407 4:183097687-183097709 CCGCAGATGCCCCGACGGGATGG 0: 1
1: 0
2: 1
3: 2
4: 72
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
984734403_984734417 25 Left 984734403 4:183097671-183097693 CCACCTTCGAGATTGGCCGCAGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
984734404_984734417 22 Left 984734404 4:183097674-183097696 CCTTCGAGATTGGCCGCAGATGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
984734414_984734417 -2 Left 984734414 4:183097698-183097720 CCGACGGGATGGCCTGGGGAGCC 0: 1
1: 0
2: 2
3: 9
4: 131
Right 984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734417 Original CRISPR CCGAAAGCTGTCCCCAGCCC CGG Intergenic
900457421 1:2783973-2783995 CCCCCAGCTGTCCCCAGTCCTGG - Intronic
900490115 1:2943866-2943888 CCCACAGCAGTCCCCAGCACGGG - Intergenic
900528717 1:3142184-3142206 CTGACAGCTGCCCCCAGCCCTGG - Intronic
900690807 1:3979154-3979176 TGTAGAGCTGTCCCCAGCCCTGG + Intergenic
900984630 1:6066196-6066218 CCGACAGCTGTCCCAGGCTCCGG - Intronic
902773956 1:18662293-18662315 CCTAAAGATGACCCCTGCCCCGG + Intronic
903238798 1:21968661-21968683 GCCAAAGCTGGGCCCAGCCCAGG - Intergenic
903242720 1:21994325-21994347 GCCAAAGCTGGGCCCAGCCCAGG - Intronic
903266263 1:22159897-22159919 CCAAAACCTCTCCCCGGCCCAGG - Intergenic
903857447 1:26345357-26345379 AGGAAGGATGTCCCCAGCCCAGG - Exonic
905361649 1:37424912-37424934 CAGACAGCTGTCTCCTGCCCTGG - Intergenic
906104551 1:43284099-43284121 CCTCTAGGTGTCCCCAGCCCTGG - Intronic
909483923 1:76153442-76153464 CAGAGAGCTGTCCCCAACTCAGG + Intronic
912728456 1:112079711-112079733 CCCAAGCCTGTCCCCAGCCATGG - Intergenic
915316501 1:155031766-155031788 CCTGCAGCTGTCCCCAGCCAGGG - Exonic
915822789 1:159043011-159043033 CCCCAAGCTGCCCCCGGCCCAGG + Intronic
916717224 1:167455840-167455862 CCGAAGGCAGGCCCCAGGCCGGG - Intronic
917028681 1:170666924-170666946 CAGAAGCCTGTCCCCAGTCCAGG - Intronic
917669220 1:177256732-177256754 CCGACAGCTGGCCCGAGCCCTGG - Intronic
920106333 1:203556093-203556115 CAGAAAGCTCTCCCTGGCCCTGG + Intergenic
920252504 1:204630899-204630921 CCAAAGTCTGTCCCCAGGCCAGG - Intronic
920511485 1:206555611-206555633 CCGGTAGCTCACCCCAGCCCCGG + Intronic
920756646 1:208739699-208739721 CCGCAAGCAGTACGCAGCCCCGG - Intergenic
923737017 1:236619737-236619759 CTGAAAACTGTGCCAAGCCCTGG - Intergenic
923784593 1:237055002-237055024 TGGGAAACTGTCCCCAGCCCTGG - Intronic
924739506 1:246786680-246786702 CAGGGAGCTGTCCCCAGCCCAGG + Intergenic
1063035791 10:2285558-2285580 CCGAAAGCTGAACCAAGCCCTGG - Intergenic
1063177900 10:3568745-3568767 CCCAAAGCTGGCCCCAGGGCAGG - Intergenic
1067277772 10:44850161-44850183 AGCAAAGCTGTTCCCAGCCCTGG + Intergenic
1069881875 10:71598265-71598287 CCAAACACTGTCCCCAGCCTAGG - Intronic
1071454376 10:85833192-85833214 CCACAAGCAGTCCCCAGCCAGGG + Intronic
1073101043 10:101006852-101006874 CCGCAAGCTGCCCCCAACCCCGG - Exonic
1073643377 10:105275380-105275402 CCCCAGGATGTCCCCAGCCCAGG - Intergenic
1073735119 10:106336542-106336564 CCCAAAGCTCACCCCAGCCACGG + Intergenic
1076290315 10:129340675-129340697 CTGAGAACTGCCCCCAGCCCCGG - Intergenic
1076679660 10:132165192-132165214 CAGACAGCCCTCCCCAGCCCTGG - Intronic
1076697569 10:132254485-132254507 ACGAAGGCTGCCCCCAGACCTGG + Intronic
1076697594 10:132254590-132254612 ACGAAGGCTGCCCCCAGACCTGG + Intronic
1076697619 10:132254695-132254717 ACGAAGGCTGCCCCCAGACCTGG + Intronic
1076887627 10:133269818-133269840 TCCAGAGCTGTCCCCAGCACCGG + Intronic
1077170239 11:1162823-1162845 CCGAAAGCAGTCTCCATCCTGGG - Intronic
1077502185 11:2914411-2914433 CAGCACGCTGGCCCCAGCCCTGG - Intronic
1080386329 11:31813084-31813106 CCGGCAGCCCTCCCCAGCCCGGG - Intronic
1083295385 11:61712544-61712566 CTGAAATCTGGCCCCAGTCCTGG + Intronic
1083964520 11:66035218-66035240 CCCAACTCTGTCTCCAGCCCAGG - Intergenic
1084463184 11:69307602-69307624 CCGAGAGCTGGCCCCAGCTCTGG - Intronic
1084517449 11:69644439-69644461 CCGACAGCTCTCCCCGCCCCTGG - Intronic
1084553525 11:69863021-69863043 CTGACATCTGTCCCCACCCCTGG + Intergenic
1087682372 11:101231677-101231699 ACGAACGCTGCCCTCAGCCCCGG + Intergenic
1089584707 11:119502880-119502902 GTGGAGGCTGTCCCCAGCCCAGG - Intergenic
1089645294 11:119874866-119874888 CCGGAAGCTGGCCCCACCCATGG - Intergenic
1090983514 11:131745487-131745509 CCGAAAGCTGTACTAAGCCAGGG - Intronic
1093857981 12:24128622-24128644 CCGAAAGCTGTCCCCAAATCAGG - Intergenic
1094800069 12:34022778-34022800 CCCCAACCTGTCCCCACCCCAGG + Intronic
1096815666 12:54200317-54200339 CCCAAAGCTCACCACAGCCCTGG + Intergenic
1098185457 12:67891708-67891730 CTGAAGGATGCCCCCAGCCCTGG - Intergenic
1104773680 12:131380418-131380440 CAGCCAGCTGTCCCTAGCCCTGG + Intergenic
1104905366 12:132210533-132210555 CAGGAAGCCGTCCCCAGCCAGGG - Intronic
1115644213 14:35356122-35356144 CACAAACCTGCCCCCAGCCCTGG - Intergenic
1119100014 14:71871031-71871053 GCCAAAGCTTTCCCCAGCCCAGG + Intergenic
1119681142 14:76593133-76593155 CCGTAACCTGTCCCCTGACCAGG + Intergenic
1121074880 14:91060117-91060139 CCGAAAGTTTTCCCCAGCCCGGG - Intronic
1121282528 14:92709623-92709645 CCAGGTGCTGTCCCCAGCCCAGG - Intronic
1122133371 14:99618951-99618973 CCCAGAGCTGTGCCCAGGCCTGG - Intergenic
1122269557 14:100562461-100562483 CCCACAGCTGTCCCCACCTCGGG + Intronic
1122369558 14:101221829-101221851 ACGACAGCTGTCTGCAGCCCAGG + Intergenic
1129288215 15:74542056-74542078 CTGAATGCTGTCCCCAGCAGAGG - Intronic
1129467564 15:75732394-75732416 CCCCAACCTGGCCCCAGCCCTGG - Intergenic
1129742970 15:77999026-77999048 CCAAAAGCTGTCCTGAGGCCTGG + Intronic
1129750637 15:78060589-78060611 CCGAGATCTGTACCCAGCCTGGG + Intronic
1129842509 15:78752421-78752443 CCAAAAGCTGTCCTGAGGCCTGG - Intergenic
1131112489 15:89774204-89774226 CCTTAACCTGGCCCCAGCCCAGG + Intronic
1131721273 15:95171167-95171189 CCCAAAGCTGACACCAGCCCAGG + Intergenic
1132342709 15:101088353-101088375 CACACAGCTGTCCCCAGCACAGG + Intergenic
1132463272 16:66058-66080 CCTGCAGCTGTCCCCAACCCAGG + Intronic
1132875303 16:2134504-2134526 CAGACAGTTGTCCCCAGCGCTGG - Intronic
1133601599 16:7345205-7345227 TTGCAAGCTGTCCACAGCCCCGG - Intronic
1134519685 16:14912886-14912908 CAGACAGTTGTCCCCAGCGCTGG + Intronic
1134554247 16:15153349-15153371 CAGACAGTTGTCCCCAGCGCTGG - Intergenic
1134707357 16:16311542-16311564 CAGACAGTTGTCCCCAGCGCTGG + Intergenic
1134960184 16:18400583-18400605 CAGACAGTTGTCCCCAGCGCTGG - Intergenic
1135205913 16:20483847-20483869 ATGAAAGCTTTCCCCACCCCTGG - Intronic
1137597498 16:49734516-49734538 CGGGAAGCCCTCCCCAGCCCTGG - Intronic
1140117582 16:72056185-72056207 CAAAAAGCTGTCCCCAGAGCAGG - Exonic
1140746741 16:77987235-77987257 TGGAAAGCTGTCCCCATGCCAGG - Intergenic
1141618295 16:85222295-85222317 CCGTGCGCTGGCCCCAGCCCGGG - Intergenic
1141791576 16:86239696-86239718 AGGACAGCTGTCCCCAGGCCTGG - Intergenic
1142032554 16:87845797-87845819 CTGAGAACTGTCCCCAGCACAGG + Intronic
1142114452 16:88348966-88348988 TCGTATGCTGTCCCCAGCTCAGG - Intergenic
1142287902 16:89178934-89178956 CCCCACGCTCTCCCCAGCCCTGG + Intronic
1143275256 17:5705520-5705542 CCGAATGCTGACCCCAGGCCAGG + Intergenic
1143508217 17:7381140-7381162 CCGCCGGCTCTCCCCAGCCCGGG - Intronic
1144621865 17:16823177-16823199 CAGGCAGCTCTCCCCAGCCCTGG + Intergenic
1144702824 17:17349932-17349954 CAGCAAGCTCCCCCCAGCCCTGG - Intergenic
1144884559 17:18449537-18449559 CAGGCAGCTCTCCCCAGCCCCGG - Intergenic
1145284457 17:21494985-21495007 CCAAAAGCTATTCCCATCCCAGG - Intergenic
1145390658 17:22453392-22453414 CCGGCAGCTGTCCCTGGCCCAGG - Intergenic
1145393001 17:22470509-22470531 TCAAAAGCTGTTCCCATCCCAGG + Intergenic
1146938399 17:36826539-36826561 CTGACAGTTGTCCCCAACCCAGG - Intergenic
1147439767 17:40440957-40440979 CAGAAAACTGCCCCCAGGCCGGG - Intergenic
1148185507 17:45640588-45640610 CCCAAGGCTGACCCCAGCCAGGG - Intergenic
1148227228 17:45907309-45907331 CCCGAAGCTTTCCCCAGCCTTGG + Intronic
1148615548 17:48997596-48997618 CCAGAAGTTGTCCCGAGCCCAGG - Exonic
1148693774 17:49547310-49547332 CCGCAAACTGCCACCAGCCCTGG - Intergenic
1151493231 17:74444707-74444729 CCGGAAGCTCTCCTCTGCCCAGG - Intronic
1152005632 17:77678624-77678646 CCAACTGCTGTCCCCAACCCTGG + Intergenic
1152361358 17:79834585-79834607 CCGCAAGCTGTCCCCGACCAAGG - Exonic
1152381195 17:79943088-79943110 CGGAACGGTGTCCCCGGCCCAGG + Intronic
1153043212 18:833312-833334 CCCAAATCTATCTCCAGCCCTGG - Intergenic
1154162447 18:11990305-11990327 CAGGAAGCTGTCCACATCCCAGG - Intronic
1155454802 18:25999683-25999705 GCAAAACCTGTCCCCATCCCTGG - Intergenic
1159558229 18:69967224-69967246 TCTACAGCTGTCTCCAGCCCGGG - Intergenic
1160134185 18:76258356-76258378 CCAAAACCTCTCACCAGCCCAGG - Intergenic
1160696051 19:484982-485004 CCCACAGCAGCCCCCAGCCCAGG - Intergenic
1161104279 19:2435539-2435561 CCATCAGCAGTCCCCAGCCCTGG - Intronic
1161150250 19:2703801-2703823 CCAAAAGCAGTACACAGCCCTGG + Intergenic
1162078724 19:8206143-8206165 CTGAAATCTCTCTCCAGCCCTGG + Intronic
1162968366 19:14166281-14166303 GTGTCAGCTGTCCCCAGCCCTGG - Intronic
1163153243 19:15427132-15427154 CCGAAAGATGTTCCCAGGCCTGG - Exonic
1163497322 19:17654553-17654575 AACACAGCTGTCCCCAGCCCAGG + Intronic
1163692387 19:18744827-18744849 CTGACTACTGTCCCCAGCCCTGG - Intronic
1163795299 19:19334492-19334514 CCCAAGGCTGCCCCCAGCCGTGG + Intronic
1164678723 19:30119992-30120014 CCGCAGGCTGTCCCTTGCCCAGG + Intergenic
1166377384 19:42335191-42335213 CCGAAAACTGCCAGCAGCCCTGG - Exonic
1167077885 19:47260222-47260244 CCTAAGTCTGGCCCCAGCCCAGG - Intronic
1168567937 19:57440266-57440288 CCCAATGCTATCCCCACCCCAGG - Intronic
925483659 2:4304219-4304241 CGGAAATGTGTCCCCTGCCCTGG - Intergenic
928200158 2:29242796-29242818 TAGAGAGCTGACCCCAGCCCCGG - Intronic
928300276 2:30118346-30118368 CAGAAAGAAGTCCCCTGCCCTGG - Intergenic
929864851 2:45709226-45709248 CGGTATGCTGGCCCCAGCCCAGG - Intronic
931954628 2:67407334-67407356 CCGCAAGCTACCCGCAGCCCAGG - Intronic
936235881 2:110742090-110742112 GCAATAGCTGTCCCCATCCCTGG - Intronic
938317443 2:130339932-130339954 CCCAAATCTCTCTCCAGCCCAGG + Intronic
941650890 2:168091466-168091488 CAGAAAGCTGCCCCAAGTCCTGG + Intronic
942215205 2:173712688-173712710 CAGAAAGCTGTCCAGAGCCAAGG + Intergenic
942320254 2:174730213-174730235 CAGCAAGCTGGCCCCAGCCCGGG - Intergenic
945997604 2:216451071-216451093 TCCAAATCTGTCTCCAGCCCTGG - Intronic
946202147 2:218076642-218076664 CCCAAAGGTGTGCCCAGTCCAGG - Intronic
948561930 2:238860086-238860108 CAGCAGGCTGTCCACAGCCCAGG + Intronic
948827109 2:240578160-240578182 CTGACAGCTGTGCCTAGCCCCGG + Exonic
949014801 2:241702856-241702878 CCCAAAGCTGTGCCCATCCCGGG - Intronic
1171254889 20:23683027-23683049 CAGAAAGCAGTCCTCAGCCAAGG - Intergenic
1171390458 20:24798453-24798475 CCGCAAGCTGAGCCCAGGCCAGG + Intergenic
1174932165 20:54827689-54827711 TCGAAAGCTGTCCCCTGCAATGG + Intergenic
1176016824 20:62938173-62938195 CCGCCACCTCTCCCCAGCCCAGG + Exonic
1178972735 21:37195286-37195308 CCCAGAGCTGTCTCCATCCCAGG - Intronic
1180078629 21:45475926-45475948 CGGAAGGCTTTCCCCAGCTCGGG + Intronic
1181500772 22:23314416-23314438 CTGCAAGCTGACTCCAGCCCTGG - Intronic
1182045529 22:27271092-27271114 CCCACAGCTGTCACCTGCCCGGG - Intergenic
1183346722 22:37312186-37312208 CGGGAAGCCGTCCCCAGACCTGG - Intronic
1184441643 22:44520419-44520441 CCGAAACCTCTCCCAAGCCTCGG - Intergenic
1185118196 22:48949947-48949969 ATGAAAGCCGTCCCCAGCACTGG + Intergenic
1185323685 22:50215420-50215442 CCAAATGCTGCCCCCAGCACAGG - Intronic
1185351569 22:50342400-50342422 CCGACGCCTGTCCCCTGCCCTGG - Intergenic
951411508 3:22372449-22372471 CCGAAAGCTCAGCCCAGCCGCGG - Intronic
954369133 3:50161089-50161111 CCCAAACCCCTCCCCAGCCCAGG + Intronic
954672222 3:52297272-52297294 TCGTGAGCTGTGCCCAGCCCAGG + Intergenic
960496708 3:118383947-118383969 CCGTAGGCTGTACCCAGCACAGG - Intergenic
962528667 3:136258411-136258433 CCTAAAGCTTTCCTCAACCCTGG - Intronic
967726762 3:192869449-192869471 CTGAAAGCTGGCTCCAGCCGAGG + Intronic
968517002 4:1019616-1019638 GCCAGAGCTGCCCCCAGCCCTGG + Intronic
968621611 4:1605764-1605786 TCGAAAGCTGTGCCCGCCCCAGG - Intergenic
968647604 4:1748335-1748357 TCAGGAGCTGTCCCCAGCCCAGG + Intergenic
968649975 4:1756698-1756720 CCTAGAGGTGGCCCCAGCCCTGG + Intergenic
972253892 4:37333147-37333169 CAGCAAGTTGTCCTCAGCCCTGG - Intronic
973327643 4:48879652-48879674 CCGAAAGCTATCCCAAGACCAGG + Intergenic
981125849 4:141105511-141105533 CCAAATGCTCTCCCCTGCCCAGG + Intronic
983448066 4:167878549-167878571 CAGAAATCTGCCCGCAGCCCGGG + Intergenic
984734417 4:183097719-183097741 CCGAAAGCTGTCCCCAGCCCCGG + Intergenic
985678447 5:1244074-1244096 CCGAGAGAAGTCTCCAGCCCAGG + Intronic
986049397 5:4074583-4074605 CCGAAATCTGTCCACTGCCCTGG - Intergenic
986424895 5:7621531-7621553 CTGAGGGCTGTCCCCAGGCCAGG - Intronic
986721514 5:10564092-10564114 GCGCCAGCTGTCCCCAGCTCTGG + Intergenic
987132601 5:14872375-14872397 CCCGAAGCAGGCCCCAGCCCCGG - Intergenic
992227697 5:74635040-74635062 CGGCCACCTGTCCCCAGCCCTGG - Exonic
992690360 5:79235927-79235949 CCGACAGCCGGCTCCAGCCCCGG + Intronic
994212061 5:97098280-97098302 CTGAATGCTGTGCTCAGCCCTGG - Intronic
996550624 5:124726319-124726341 CCCATAGGTGTCTCCAGCCCTGG + Intronic
998138220 5:139685458-139685480 CTCACAGCTGTCCCCACCCCTGG - Intergenic
998205693 5:140155457-140155479 CCTAACCCTGGCCCCAGCCCTGG - Intergenic
999257783 5:150219280-150219302 GAGAAAGCTGACCCCATCCCTGG + Intronic
999321498 5:150618290-150618312 CACACAGCTGGCCCCAGCCCAGG + Exonic
1000074047 5:157768189-157768211 CCAAGAACTGTCCCCATCCCTGG - Intergenic
1001941906 5:175746349-175746371 AGGAAAGCTGATCCCAGCCCAGG + Intergenic
1002305449 5:178280159-178280181 CCGAAGGCTGCCTCCAGCCCTGG + Intronic
1002367242 5:178723195-178723217 GAGAAAGCTCTCCCCAGCACAGG + Intronic
1002386248 5:178869288-178869310 GAGAAAGCTCTCCCCAGCACAGG - Intronic
1002518312 5:179775256-179775278 CAGAAACTTGTCCCCAGCACTGG - Exonic
1005348293 6:24910983-24911005 ACGCGAGCTGTCCCCAGCGCCGG + Intronic
1006385705 6:33729604-33729626 TGGAAAGCTGTCACCACCCCAGG - Intronic
1006452155 6:34111588-34111610 CAGAAAGCTGTCCCCTGCCGGGG - Intronic
1007321973 6:41034095-41034117 CCCATCGCTGTCCCAAGCCCAGG - Exonic
1007485533 6:42178445-42178467 CAGACCGCTGCCCCCAGCCCTGG - Intronic
1007759986 6:44127905-44127927 CCGCCGGCTCTCCCCAGCCCCGG + Intronic
1011894697 6:92211117-92211139 TTGTAAACTGTCCCCAGCCCAGG + Intergenic
1015117239 6:129663155-129663177 CTGAAATCTGTCCCCAGCAAGGG + Intronic
1016409033 6:143762319-143762341 ATGAAAGCTGTCCCCTGACCTGG - Intronic
1016534298 6:145093201-145093223 CAGCAGGCTGTCCCCAGCCAAGG - Intergenic
1019496078 7:1341258-1341280 CCCAAAGAAGTCCCCAGCCATGG - Intergenic
1023859678 7:44210765-44210787 CAAAAAGCTGTCCCCAGCACAGG - Intronic
1023983302 7:45081832-45081854 CCGAATGCTGGCCCGAGCCCAGG + Exonic
1029440597 7:100584868-100584890 CCGAAGCCTCACCCCAGCCCAGG - Intronic
1032097395 7:128946373-128946395 CCCAAAGCTGCCCCCAACACAGG - Intronic
1033732814 7:144195603-144195625 CCCAGAGCCGTCCCCAGCGCAGG + Exonic
1033743665 7:144294183-144294205 CCCAGAGCCGTCCCCAGCGCAGG + Intergenic
1033750237 7:144355414-144355436 CCCAGAGCCGTCCCCAGCGCAGG - Exonic
1034392781 7:150799957-150799979 CCGGACGCTTTCCCCAGCCCCGG - Intronic
1034493598 7:151407473-151407495 CCACAACCCGTCCCCAGCCCAGG + Intronic
1036946656 8:13100601-13100623 CCGAAGGACGGCCCCAGCCCCGG - Exonic
1040355856 8:46617587-46617609 CGGCATGCTGTCCACAGCCCTGG - Intergenic
1040819138 8:51535968-51535990 TGTAAAGCTGACCCCAGCCCTGG + Intronic
1048525847 8:135201768-135201790 CAGAAAGATGTCCCCTGGCCAGG - Intergenic
1049198972 8:141330714-141330736 CCAAGGGCTGGCCCCAGCCCTGG - Intergenic
1049526860 8:143131279-143131301 CGGACACCCGTCCCCAGCCCTGG + Intergenic
1058754315 9:108070460-108070482 CCAAATGCTGTTCCCAGCACTGG + Intergenic
1060580429 9:124740853-124740875 CCCAAAGATAACCCCAGCCCTGG + Intronic
1061238087 9:129353494-129353516 CCTGCAGCTGTCCCCAGCCTTGG - Intergenic
1061935819 9:133857101-133857123 CCGAAAGGTGTCCTCAGGCTGGG - Intronic
1062196318 9:135276176-135276198 TCTAAAAATGTCCCCAGCCCGGG + Intergenic
1062429435 9:136520436-136520458 CCAAAACCAGACCCCAGCCCTGG + Intronic
1185835958 X:3346206-3346228 CCCAAAGCGCTCCCCATCCCTGG - Intronic
1186790519 X:12993197-12993219 TCAAAATCTGTCCTCAGCCCTGG - Intergenic
1189180036 X:38995109-38995131 CCTATAGCTGTCCCCAGTTCTGG - Intergenic
1189538119 X:41957436-41957458 TCATAAGGTGTCCCCAGCCCCGG - Intergenic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1200049395 X:153420770-153420792 CCGAACTCTGCCCCAAGCCCTGG - Exonic