ID: 984734924

View in Genome Browser
Species Human (GRCh38)
Location 4:183099612-183099634
Sequence GCCGGCGCCCACCTGTCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734924_984734936 6 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734936 4:183099641-183099663 GGCGCGGGCCCGTTCGGACACGG 0: 1
1: 0
2: 0
3: 2
4: 28
984734924_984734935 0 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734935 4:183099635-183099657 CGCGGGGGCGCGGGCCCGTTCGG 0: 1
1: 0
2: 2
3: 10
4: 128
984734924_984734937 9 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734937 4:183099644-183099666 GCGGGCCCGTTCGGACACGGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
984734924_984734941 29 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734924_984734932 -9 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734932 4:183099626-183099648 GGCGCCGGCCGCGGGGGCGCGGG 0: 1
1: 1
2: 14
3: 193
4: 2426
984734924_984734931 -10 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734931 4:183099625-183099647 GGGCGCCGGCCGCGGGGGCGCGG 0: 1
1: 0
2: 11
3: 191
4: 1350
984734924_984734940 21 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734924 Original CRISPR GCCGGCGCCCACCTGTCCCG GGG (reversed) Exonic