ID: 984734925

View in Genome Browser
Species Human (GRCh38)
Location 4:183099613-183099635
Sequence GGCCGGCGCCCACCTGTCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734925_984734932 -10 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734932 4:183099626-183099648 GGCGCCGGCCGCGGGGGCGCGGG 0: 1
1: 1
2: 14
3: 193
4: 2426
984734925_984734936 5 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734936 4:183099641-183099663 GGCGCGGGCCCGTTCGGACACGG 0: 1
1: 0
2: 0
3: 2
4: 28
984734925_984734941 28 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734925_984734940 20 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734925_984734937 8 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734937 4:183099644-183099666 GCGGGCCCGTTCGGACACGGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
984734925_984734935 -1 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734935 4:183099635-183099657 CGCGGGGGCGCGGGCCCGTTCGG 0: 1
1: 0
2: 2
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734925 Original CRISPR GGCCGGCGCCCACCTGTCCC GGG (reversed) Exonic