ID: 984734926

View in Genome Browser
Species Human (GRCh38)
Location 4:183099614-183099636
Sequence CGGCCGGCGCCCACCTGTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734926_984734935 -2 Left 984734926 4:183099614-183099636 CCGGGACAGGTGGGCGCCGGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 984734935 4:183099635-183099657 CGCGGGGGCGCGGGCCCGTTCGG 0: 1
1: 0
2: 2
3: 10
4: 128
984734926_984734940 19 Left 984734926 4:183099614-183099636 CCGGGACAGGTGGGCGCCGGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734926_984734937 7 Left 984734926 4:183099614-183099636 CCGGGACAGGTGGGCGCCGGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 984734937 4:183099644-183099666 GCGGGCCCGTTCGGACACGGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
984734926_984734941 27 Left 984734926 4:183099614-183099636 CCGGGACAGGTGGGCGCCGGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734926_984734936 4 Left 984734926 4:183099614-183099636 CCGGGACAGGTGGGCGCCGGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 984734936 4:183099641-183099663 GGCGCGGGCCCGTTCGGACACGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734926 Original CRISPR CGGCCGGCGCCCACCTGTCC CGG (reversed) Exonic