ID: 984734933

View in Genome Browser
Species Human (GRCh38)
Location 4:183099630-183099652
Sequence CGGGCCCGCGCCCCCGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 2, 2: 2, 3: 35, 4: 516}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734933_984734945 21 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734945 4:183099674-183099696 CCCGGAGACCCGGCCGCGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 184
984734933_984734947 22 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734947 4:183099675-183099697 CCGGAGACCCGGCCGCGCGGGGG 0: 1
1: 1
2: 2
3: 9
4: 138
984734933_984734950 28 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734950 4:183099681-183099703 ACCCGGCCGCGCGGGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 170
984734933_984734941 11 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734933_984734952 29 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734952 4:183099682-183099704 CCCGGCCGCGCGGGGGGCTGGGG 0: 1
1: 0
2: 3
3: 223
4: 7725
984734933_984734937 -9 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734937 4:183099644-183099666 GCGGGCCCGTTCGGACACGGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
984734933_984734940 3 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734933_984734942 19 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734942 4:183099672-183099694 GTCCCGGAGACCCGGCCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 106
984734933_984734948 23 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734948 4:183099676-183099698 CGGAGACCCGGCCGCGCGGGGGG 0: 1
1: 0
2: 2
3: 17
4: 152
984734933_984734949 27 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734949 4:183099680-183099702 GACCCGGCCGCGCGGGGGGCTGG 0: 1
1: 1
2: 3
3: 34
4: 357
984734933_984734943 20 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734943 4:183099673-183099695 TCCCGGAGACCCGGCCGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734933 Original CRISPR CGGGCCCGCGCCCCCGCGGC CGG (reversed) Intronic