ID: 984734938

View in Genome Browser
Species Human (GRCh38)
Location 4:183099649-183099671
Sequence AACAGCCGCCGTGTCCGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734938_984734948 4 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734948 4:183099676-183099698 CGGAGACCCGGCCGCGCGGGGGG 0: 1
1: 0
2: 2
3: 17
4: 152
984734938_984734947 3 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734947 4:183099675-183099697 CCGGAGACCCGGCCGCGCGGGGG 0: 1
1: 1
2: 2
3: 9
4: 138
984734938_984734950 9 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734950 4:183099681-183099703 ACCCGGCCGCGCGGGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 170
984734938_984734942 0 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734942 4:183099672-183099694 GTCCCGGAGACCCGGCCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 106
984734938_984734943 1 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734943 4:183099673-183099695 TCCCGGAGACCCGGCCGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 104
984734938_984734941 -8 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734938_984734949 8 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734949 4:183099680-183099702 GACCCGGCCGCGCGGGGGGCTGG 0: 1
1: 1
2: 3
3: 34
4: 357
984734938_984734957 26 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734957 4:183099698-183099720 GCTGGGGCGGCGCCGGCCCGCGG 0: 1
1: 1
2: 3
3: 53
4: 591
984734938_984734952 10 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734952 4:183099682-183099704 CCCGGCCGCGCGGGGGGCTGGGG 0: 1
1: 0
2: 3
3: 223
4: 7725
984734938_984734945 2 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734945 4:183099674-183099696 CCCGGAGACCCGGCCGCGCGGGG 0: 1
1: 0
2: 2
3: 15
4: 184
984734938_984734954 13 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734954 4:183099685-183099707 GGCCGCGCGGGGGGCTGGGGCGG 0: 1
1: 1
2: 8
3: 138
4: 1307
984734938_984734956 19 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734956 4:183099691-183099713 GCGGGGGGCTGGGGCGGCGCCGG 0: 1
1: 1
2: 25
3: 243
4: 2012

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734938 Original CRISPR AACAGCCGCCGTGTCCGAAC GGG (reversed) Intronic