ID: 984734940

View in Genome Browser
Species Human (GRCh38)
Location 4:183099656-183099678
Sequence GGACACGGCGGCTGTTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734934_984734940 -1 Left 984734934 4:183099634-183099656 CCGCGGGGGCGCGGGCCCGTTCG 0: 1
1: 0
2: 1
3: 5
4: 71
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734933_984734940 3 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734922_984734940 22 Left 984734922 4:183099611-183099633 CCCCCGGGACAGGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734926_984734940 19 Left 984734926 4:183099614-183099636 CCGGGACAGGTGGGCGCCGGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734924_984734940 21 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
984734925_984734940 20 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734940 4:183099656-183099678 GGACACGGCGGCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734940 Original CRISPR GGACACGGCGGCTGTTGTCC CGG Intronic