ID: 984734941

View in Genome Browser
Species Human (GRCh38)
Location 4:183099664-183099686
Sequence CGGCTGTTGTCCCGGAGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734933_984734941 11 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734925_984734941 28 Left 984734925 4:183099613-183099635 CCCGGGACAGGTGGGCGCCGGCC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734926_984734941 27 Left 984734926 4:183099614-183099636 CCGGGACAGGTGGGCGCCGGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734922_984734941 30 Left 984734922 4:183099611-183099633 CCCCCGGGACAGGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734934_984734941 7 Left 984734934 4:183099634-183099656 CCGCGGGGGCGCGGGCCCGTTCG 0: 1
1: 0
2: 1
3: 5
4: 71
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734939_984734941 -9 Left 984734939 4:183099650-183099672 CCGTTCGGACACGGCGGCTGTTG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734924_984734941 29 Left 984734924 4:183099612-183099634 CCCCGGGACAGGTGGGCGCCGGC 0: 1
1: 0
2: 2
3: 14
4: 140
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120
984734938_984734941 -8 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734941 4:183099664-183099686 CGGCTGTTGTCCCGGAGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734941 Original CRISPR CGGCTGTTGTCCCGGAGACC CGG Intronic