ID: 984734952

View in Genome Browser
Species Human (GRCh38)
Location 4:183099682-183099704
Sequence CCCGGCCGCGCGGGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7952
Summary {0: 1, 1: 0, 2: 3, 3: 223, 4: 7725}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984734938_984734952 10 Left 984734938 4:183099649-183099671 CCCGTTCGGACACGGCGGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 984734952 4:183099682-183099704 CCCGGCCGCGCGGGGGGCTGGGG 0: 1
1: 0
2: 3
3: 223
4: 7725
984734939_984734952 9 Left 984734939 4:183099650-183099672 CCGTTCGGACACGGCGGCTGTTG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 984734952 4:183099682-183099704 CCCGGCCGCGCGGGGGGCTGGGG 0: 1
1: 0
2: 3
3: 223
4: 7725
984734933_984734952 29 Left 984734933 4:183099630-183099652 CCGGCCGCGGGGGCGCGGGCCCG 0: 1
1: 2
2: 2
3: 35
4: 516
Right 984734952 4:183099682-183099704 CCCGGCCGCGCGGGGGGCTGGGG 0: 1
1: 0
2: 3
3: 223
4: 7725
984734934_984734952 25 Left 984734934 4:183099634-183099656 CCGCGGGGGCGCGGGCCCGTTCG 0: 1
1: 0
2: 1
3: 5
4: 71
Right 984734952 4:183099682-183099704 CCCGGCCGCGCGGGGGGCTGGGG 0: 1
1: 0
2: 3
3: 223
4: 7725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984734952 Original CRISPR CCCGGCCGCGCGGGGGGCTG GGG Intronic