ID: 984736478

View in Genome Browser
Species Human (GRCh38)
Location 4:183113268-183113290
Sequence ATGTAGAAACAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984736473_984736478 -7 Left 984736473 4:183113252-183113274 CCATCAGCACAGATTGATGTAGA 0: 1
1: 0
2: 2
3: 12
4: 132
Right 984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG No data
984736472_984736478 15 Left 984736472 4:183113230-183113252 CCACTGCAAATACAGAACGTTTC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984736478 Original CRISPR ATGTAGAAACAGAGGGAGGA GGG Intronic
No off target data available for this crispr