ID: 984743926

View in Genome Browser
Species Human (GRCh38)
Location 4:183195377-183195399
Sequence GTGTTGAGAAGGAGGCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984743926_984743931 12 Left 984743926 4:183195377-183195399 CCTCTTAGCCTCCTTCTCAACAC 0: 1
1: 0
2: 1
3: 21
4: 219
Right 984743931 4:183195412-183195434 TGGTATCTAAACCCACCTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 78
984743926_984743932 13 Left 984743926 4:183195377-183195399 CCTCTTAGCCTCCTTCTCAACAC 0: 1
1: 0
2: 1
3: 21
4: 219
Right 984743932 4:183195413-183195435 GGTATCTAAACCCACCTTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 77
984743926_984743929 -8 Left 984743926 4:183195377-183195399 CCTCTTAGCCTCCTTCTCAACAC 0: 1
1: 0
2: 1
3: 21
4: 219
Right 984743929 4:183195392-183195414 CTCAACACCTACAAACTCTTTGG 0: 1
1: 0
2: 0
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984743926 Original CRISPR GTGTTGAGAAGGAGGCTAAG AGG (reversed) Intronic
902304434 1:15525396-15525418 GGGTGGAGGAGGGGGCTAAGGGG - Intronic
902991203 1:20188133-20188155 GACTTGAGAAGGAGACTAAAGGG + Intronic
903441007 1:23387794-23387816 GTCTAGAGAGGAAGGCTAAGGGG - Intronic
903918824 1:26784922-26784944 GTGTAGAGAAGGAAGTTAGGTGG - Intergenic
906309957 1:44746688-44746710 GTGATGAGAATGAGGTGAAGAGG - Intronic
908066232 1:60408228-60408250 CTCTTGAGAATGAGGTTAAGAGG - Intergenic
908162230 1:61421697-61421719 GTGCCCAGAAGGAGGCTAAGTGG - Intronic
912212355 1:107569658-107569680 GACTGGAGAAGGAGGCTGAGTGG - Intergenic
912388026 1:109282296-109282318 GTGTTAAGAAGAAGGATAAGTGG - Intronic
913185673 1:116368735-116368757 GTGTTGTGAACTAGGGTAAGGGG + Intergenic
915232625 1:154456867-154456889 GTGTTGGGAAAGGGGCTGAGAGG + Intronic
915470527 1:156123257-156123279 CAGTTGAGAAGGAGGCTATTTGG + Intronic
917145817 1:171890032-171890054 GTGCTGAGAACTAGGATAAGAGG + Intronic
917675085 1:177311318-177311340 GTCTTGACAAGGAGGGAAAGGGG + Intergenic
920604115 1:207363347-207363369 GTGTAGGGAAGGAGGCAAGGAGG - Intergenic
921364610 1:214361922-214361944 GTGTTTAGAATGAGACTGAGAGG + Intronic
921949812 1:220917608-220917630 GTGTTTCAAAGGAGGCTGAGAGG + Intergenic
922022093 1:221715916-221715938 GAGTGGAGAAGGGGGCAAAGGGG - Intronic
923188966 1:231601804-231601826 CTGTTGAGAAGAAAGCTAAGGGG - Intronic
923457725 1:234179096-234179118 GAGTCGTGAAGGAGGCTCAGTGG - Intronic
1063427101 10:5959035-5959057 GTGATGATAAGGAGGAAAAGGGG - Intronic
1065758519 10:28958852-28958874 GTAGGGAGAAGGAGGTTAAGGGG + Intergenic
1068757195 10:60669074-60669096 GTTTTGAGAAAGGGGCTAAGTGG + Intronic
1069801302 10:71083579-71083601 GTGTGGGGAAGGAGACTCAGGGG + Intergenic
1071964217 10:90835745-90835767 GAGTAGAGAAGGAAGCTCAGGGG + Intronic
1072042473 10:91621782-91621804 CTGAAGGGAAGGAGGCTAAGAGG + Intergenic
1072185296 10:93032078-93032100 CTGTGGAGACGAAGGCTAAGGGG - Intronic
1076053291 10:127352107-127352129 GGGTGGTGAAGGAGGCTGAGGGG - Intronic
1078364493 11:10694805-10694827 GTGCTGGGATGGAGGCTCAGTGG - Intergenic
1081302964 11:41476109-41476131 GTGTTGAGAGAGAGACTAGGTGG - Intergenic
1081555219 11:44153550-44153572 GTGTTGAAAAGGAGTGTGAGAGG + Intronic
1081907319 11:46678209-46678231 GTGTGGGAAAGGAGGCCAAGAGG + Exonic
1082699928 11:56416370-56416392 GTGTTAAGAATGAGGTTAATTGG - Intergenic
1083856285 11:65394586-65394608 GTGAGGAAAAGGAGGCTGAGGGG - Intronic
1089092195 11:115887425-115887447 GTGGTGAGAAGGTGGCTGTGTGG + Intergenic
1089197536 11:116703457-116703479 GTGAGGAGAAGCAGGCTCAGAGG + Intergenic
1090930186 11:131290649-131290671 CTGTTGAGACGGAGGCAGAGAGG - Intergenic
1091118139 11:133034110-133034132 ATTTTGAGAAAGAGGCTGAGGGG + Intronic
1091410788 12:237868-237890 GTGTTCAGAAGAAGGGTATGGGG - Intronic
1091761104 12:3087927-3087949 GTGTGGAGACTGAGGCTTAGGGG + Intronic
1091818933 12:3459900-3459922 GTGCTGAGAATGAGGTTGAGAGG + Intronic
1092896766 12:13019512-13019534 ATGATGAGAAGGAGGAGAAGAGG + Intergenic
1093807506 12:23452396-23452418 GTGTTGAGCAAGAGGCTGTGAGG - Intergenic
1094159752 12:27378032-27378054 CTGATGAGAAAGAGGGTAAGTGG - Intronic
1094252605 12:28381856-28381878 GAGTTGAGAAGAAGCCTCAGAGG - Intronic
1094695106 12:32810010-32810032 TTGTTGAGATGGGGGCCAAGAGG - Intronic
1096159686 12:49366678-49366700 GGGTCGGGAAGGAGGCGAAGGGG + Intronic
1097274312 12:57801824-57801846 TTATTGATAAGGAAGCTAAGAGG - Intronic
1101092151 12:101298300-101298322 GTGTTGAGAGGGAGACTGAATGG + Intronic
1102940435 12:116936780-116936802 GTGGTGAGCAGAAGGATAAGAGG + Intronic
1104926508 12:132316731-132316753 GTGATGGGAAGGAGGCTGGGTGG - Intronic
1105436471 13:20382944-20382966 GTATTGGGAAGGAGGAAAAGTGG + Intergenic
1106304628 13:28498599-28498621 GCGTGGAGAAGGAAGCAAAGGGG + Intergenic
1106915586 13:34510640-34510662 GTGTTGAGCAGGAGGCAGAAAGG - Intergenic
1108283561 13:48883315-48883337 ATGTTGAGAAGTAGCCTCAGAGG - Intergenic
1112625248 13:101096556-101096578 GTCTTGAGGTGGAGGCTAAAGGG + Intronic
1112879945 13:104094529-104094551 GTGAGGAGAAGCAGGCTGAGGGG - Intergenic
1114616824 14:24072824-24072846 GTCTAGGGAAGGAGGTTAAGGGG + Intronic
1114704402 14:24710804-24710826 GCGCTGAGAAGGCGGCTGAGAGG - Intergenic
1115104128 14:29739226-29739248 GTGTAGAGAAGAAGACTAACCGG - Intronic
1116569921 14:46503150-46503172 TGGTTGAGAAGAAGGCTCAGAGG + Intergenic
1117331345 14:54715298-54715320 GTGCTAAGAAGGAGCCTTAGGGG - Intronic
1118277356 14:64397306-64397328 GTTTTGAGACGGAGTCTCAGTGG + Intronic
1118328655 14:64799267-64799289 GTCCTGAGAAGCAGGCTAAGTGG + Intronic
1118454128 14:65929691-65929713 GTGGTGGGAAGGAGGCAAAAGGG + Intergenic
1120408818 14:84124180-84124202 GTGTCGAGAAGAAGGATGAGAGG - Intergenic
1120536735 14:85705775-85705797 GTGTTGAAAATAAGGTTAAGGGG + Intergenic
1120738233 14:88079001-88079023 GGGTTGAGAAAAAGGATAAGAGG - Intergenic
1122249951 14:100430821-100430843 CTGTCGAGAAGGGGCCTAAGAGG + Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1126358936 15:47825514-47825536 GTGTTGCGAGTGAGGCTTAGTGG + Intergenic
1127142579 15:55993215-55993237 GTGTTGAGGAGGGGGCTAGGCGG - Intronic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1128532977 15:68467590-68467612 CTGTCATGAAGGAGGCTAAGGGG - Intergenic
1129294659 15:74593310-74593332 GTGTTCAGACAGAGGGTAAGAGG - Intronic
1129375349 15:75126732-75126754 GTGTAGAGAAGGAGCCTTGGCGG - Intergenic
1129998731 15:80028943-80028965 GTGTTGAGAAGGATTCTGAGGGG + Intergenic
1131374647 15:91913553-91913575 GGTTTGAAAATGAGGCTAAGAGG + Intronic
1131663185 15:94540784-94540806 GTGTTAAGAAAGAAACTAAGAGG + Intergenic
1135383603 16:22015105-22015127 GGGTTGCCTAGGAGGCTAAGAGG - Intronic
1136096504 16:27960833-27960855 ATGTTTACAAGGAGGCTGAGTGG - Intronic
1141427992 16:83956015-83956037 GTGAGGAGAAGGAGGCTCCGAGG - Intronic
1141590625 16:85066386-85066408 GGTTTGAGAAGGATGCTGAGAGG + Intronic
1142327147 16:89423125-89423147 GTGTTGGGAAGGTGGCTCACGGG - Intronic
1144443082 17:15301479-15301501 GAGTTGAGAAGGATCCTGAGAGG - Intergenic
1146277963 17:31526902-31526924 GTTTTGAGACGGAGTCTCAGTGG - Intronic
1148715686 17:49714068-49714090 GTGTTGGGAAGGTGACCAAGGGG + Intronic
1150571071 17:66387759-66387781 TTGTTGAGAAGGAGCCGCAGGGG + Intronic
1150984786 17:70183993-70184015 GTGGCTAGAAGGAGGCTAGGAGG - Intergenic
1151006148 17:70438268-70438290 GTGTTGGGAAGGTGGGTAAGAGG + Intergenic
1152991223 18:365677-365699 TTTTTTAGAGGGAGGCTAAGAGG - Intronic
1153799002 18:8652117-8652139 TTATTGAGAAGGAGTCTCAGTGG + Intergenic
1157477657 18:48033778-48033800 GTGTAAAGAAGGAGGCTGTGTGG - Intronic
1160509955 18:79447858-79447880 GTGCAGAGAAGGAGGGTGAGAGG + Intronic
1163942449 19:20507836-20507858 GTATAGAGAAGCAGGCTGAGTGG + Intergenic
1164956788 19:32393117-32393139 GTGCTGATAAGGAGGGAAAGAGG + Intergenic
1165161529 19:33819762-33819784 GTGTTAAGAAGGATCCTAGGAGG - Intergenic
1166545771 19:43634362-43634384 ATGTGGAGAATGAGGCTTAGCGG + Intronic
1166696765 19:44856317-44856339 GTGTTGGGGAGGAGGCTAATAGG - Intronic
1167212131 19:48139844-48139866 GGGTTGAGGAGAAGGCTGAGAGG - Intronic
1168114030 19:54210928-54210950 GTGCTGATAAGGATTCTAAGTGG + Intronic
1168697070 19:58409494-58409516 CTGTTGAGCAGGAGGCAAACTGG + Intronic
925769609 2:7269120-7269142 GAGCTGAGAAAGAGGCAAAGTGG + Intergenic
925904807 2:8534150-8534172 GTGTTGAGAAGGAAGCCACATGG - Intergenic
926043207 2:9691262-9691284 GTGATGAGACTGAGGCTCAGAGG - Intergenic
926594352 2:14774177-14774199 GTGTTGAGATGGAGACTCTGTGG - Intergenic
927786373 2:25977976-25977998 GTGTTCAGATGGAAGCAAAGGGG - Intronic
927860454 2:26557284-26557306 GTGGTGAGAAGGGGGCAGAGAGG - Intronic
927962791 2:27250977-27250999 GAGTGGAGAAGGAGGATAGGAGG + Intergenic
928241752 2:29592538-29592560 GTGAGGAGAAGGAGGCTTTGTGG - Intronic
930368871 2:50478993-50479015 GTGTTGATGAGGAGGCTGAATGG - Intronic
932006384 2:67931534-67931556 GTGTTGAGAAGTAAGATGAGTGG - Intergenic
932259576 2:70315708-70315730 GTGTTGGGAAGCAGGAGAAGAGG + Intergenic
932510332 2:72280801-72280823 GTGTTGAAAGAGAGGCAAAGAGG + Intronic
932696867 2:73964372-73964394 TTGTTGAGAATGAGTGTAAGTGG - Intergenic
933741185 2:85535496-85535518 GTGTTGAGAAGGAGGTTCCTAGG - Intergenic
933748907 2:85590700-85590722 CTGTGGGGAAGTAGGCTAAGAGG + Intronic
934147509 2:89110090-89110112 GTATAGAAAAGGAGGCAAAGGGG + Intergenic
934221761 2:90090501-90090523 GTATAGAAAAGGAGGCAAAGGGG - Intergenic
938979053 2:136508278-136508300 GGGTTGAGAAGGAGGCTCAGAGG - Intergenic
941493671 2:166174353-166174375 TTGTTGAGAATGATGGTAAGAGG + Intergenic
941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG + Intronic
944284958 2:197939056-197939078 GTGGTGAGAAGGAGGATCAATGG + Intronic
945917287 2:215717280-215717302 GCCTTGAGCAGGAGGCAAAGGGG + Intergenic
946088033 2:217194322-217194344 GAATTGAGGAGGAGGCTAAGAGG + Intergenic
946599216 2:221340936-221340958 GTGTGGATGAGGAGGCTCAGAGG - Intergenic
947634578 2:231673491-231673513 GGGAGGAGAAGGAGCCTAAGAGG - Intergenic
948027991 2:234793076-234793098 TTGGTGAGGAGGAGACTAAGGGG - Intergenic
1168973171 20:1944914-1944936 GTGATGAGAAGGAGGATGAGAGG + Intergenic
1169059846 20:2653254-2653276 GGGGGGAGAAAGAGGCTAAGTGG - Intronic
1169426678 20:5502471-5502493 GGGATGAGAAGGAGGCACAGTGG - Intergenic
1170360217 20:15537774-15537796 GTTGTGAGAAGAAGGGTAAGTGG - Intronic
1170487103 20:16829503-16829525 GTGGTGATTAGGAGGTTAAGAGG - Intergenic
1171351217 20:24504732-24504754 GAGTTGAGACGGAGACTAAACGG + Intronic
1172953841 20:38741034-38741056 GTGTAGAGAAAGAGGGAAAGAGG - Intergenic
1174075741 20:47934708-47934730 TGGTTGAGAAGAAGGCTTAGAGG + Intergenic
1174411402 20:50339046-50339068 GTGATGCGAAGGAGGCCAGGTGG + Intergenic
1177220945 21:18192106-18192128 GTGTTGAGAAGGAGGGACAGGGG - Intronic
1178048750 21:28725524-28725546 GTGGTTAGGAGAAGGCTAAGGGG - Intergenic
1178131831 21:29582021-29582043 ATGGTTAGAAGGAGTCTAAGTGG + Intronic
1179031861 21:37727550-37727572 ATGTTGAGAAGGAGCCAAAAGGG + Intronic
1182008065 22:26977979-26978001 GTGTTGGCAAGGAGTCTAACAGG + Intergenic
1182043464 22:27256471-27256493 GTGGAGAGATGGAGGCTCAGAGG - Intergenic
1182422423 22:30254870-30254892 GTGGAGGGGAGGAGGCTAAGTGG + Intergenic
1182832192 22:33313282-33313304 GAGTTGAGTTGGAGGCTGAGTGG - Intronic
949491000 3:4588918-4588940 GTGGTGAGAAGTAGGCAAATTGG - Intronic
952378889 3:32789178-32789200 GTGTTGAGACTGAGGTTCAGAGG - Intergenic
953885996 3:46714628-46714650 GTGGTGAGGAGTAGGCTCAGGGG - Intronic
956134290 3:66083559-66083581 GGGATGAGAAGGAGGCTACTGGG + Intergenic
962321279 3:134392663-134392685 GTGTGGAGAAGGAGGATCAGTGG + Intergenic
962421153 3:135230188-135230210 GGGTTCAGGAGGAGGCTCAGAGG - Intronic
962924933 3:139984124-139984146 GACTTGAGAAGGAGAGTAAGAGG + Intronic
963154076 3:142077438-142077460 GAGTGGAGAAGGAAGTTAAGAGG + Intronic
963379147 3:144506509-144506531 GTCTGGGGAAGGAGGCTGAGTGG + Intergenic
966739469 3:183218758-183218780 GTTTTGTGAAGGAGGGTTAGCGG - Intronic
967558706 3:190892936-190892958 GTGTTTGGAAGGAGGTGAAGGGG + Intergenic
968260124 3:197314865-197314887 TAGTTGAGAAGGAGACTAACAGG + Intergenic
969424536 4:7116415-7116437 GTGACGAAATGGAGGCTAAGAGG - Intergenic
971857555 4:32062080-32062102 GTCTGGAGAAAGAGGCTGAGTGG + Intergenic
971994840 4:33952431-33952453 GTGTTGAGAAGAAGGTTGATAGG - Intergenic
972862016 4:43180759-43180781 GTGTAGAGAAAGAGGCCAAGGGG - Intergenic
974793969 4:66724931-66724953 GTGATGAGAAGGAAGCTTTGTGG + Intergenic
974939953 4:68455055-68455077 GTATTGAGAAGTTGGTTAAGGGG - Intronic
975024623 4:69532914-69532936 GGATGGAGAAGGAGGCTGAGTGG - Intergenic
975281050 4:72563373-72563395 GTGTGGTGAAGGAGGTTTAGGGG - Intronic
975425728 4:74224856-74224878 GTCTTGAGAAGGTGTCTAGGAGG - Intronic
977868858 4:102064944-102064966 GTGTAGAGAGGTAGCCTAAGAGG + Intronic
984743926 4:183195377-183195399 GTGTTGAGAAGGAGGCTAAGAGG - Intronic
986227402 5:5828525-5828547 GTCATGAGAAGGAGGCCAGGTGG - Intergenic
989139655 5:38190104-38190126 GTGTTGGGGACCAGGCTAAGAGG - Intergenic
989318066 5:40104845-40104867 GTGCAGAGAAGCAGGCTGAGTGG - Intergenic
991311091 5:65242860-65242882 GTGTGGAGAGGGATGTTAAGAGG + Intronic
991398873 5:66233379-66233401 GTGTTGAGAAAATGGCTTAGGGG + Intergenic
994303708 5:98177957-98177979 GTGTTGAGGAAGAGACCAAGTGG - Intergenic
997440348 5:133904804-133904826 GGGTGGAGACGGAGGCCAAGAGG + Intergenic
999682423 5:154072639-154072661 GTGTTGAGCACGAGGCTCTGGGG - Intronic
1001541065 5:172539810-172539832 GTGATGGGATGGAGGCTCAGAGG + Intergenic
1002585023 5:180239787-180239809 CTGGGGAGAAAGAGGCTAAGTGG + Intronic
1004420917 6:15469156-15469178 GTGTGGAGGAGGAGGATAAAAGG + Intronic
1005012267 6:21347354-21347376 GAGGAGAGAAGGAGGCCAAGAGG + Intergenic
1006378735 6:33685644-33685666 GTATCGAGAAGGAGGCCACGCGG - Exonic
1007332807 6:41126976-41126998 GGATTGATAAGGAGTCTAAGAGG - Intergenic
1012451482 6:99356714-99356736 TAGTTGAGAAGAAGGCTTAGTGG + Intergenic
1012820873 6:104083539-104083561 GGCTGGAGAAAGAGGCTAAGTGG - Intergenic
1015997434 6:139008964-139008986 TTGATGAGAAGAAGGCCAAGGGG + Intergenic
1016326518 6:142908710-142908732 GGGTTGAGAAGGGTGCTAAGTGG + Intronic
1019169586 6:170125132-170125154 GTGTTGAGAAGGGTTCTGAGGGG - Intergenic
1019916876 7:4139062-4139084 GTGTTGGGGACGAGGCTAACAGG + Intronic
1021562436 7:21981844-21981866 GTATTGGGAAGGAGGCCAGGGGG - Intergenic
1028668774 7:93376826-93376848 GTGTACAGAAGGAGGATAACTGG + Intergenic
1029488715 7:100858756-100858778 GTGTGGAGAGGGTGGCTAAGAGG + Intronic
1032463898 7:132131519-132131541 GAGATGAGAAGGAGGCTCAAGGG + Intronic
1033254162 7:139785120-139785142 GTGTGGAGAGAGAGGCTAAGAGG + Intronic
1035988204 8:4457789-4457811 GTGGTGAGAAGCCAGCTAAGAGG - Intronic
1036760140 8:11503018-11503040 GAGATGAGAAGGAGCCCAAGGGG - Intronic
1037376128 8:18230995-18231017 ATGTAGAGAAGGTGGCTAATGGG + Intergenic
1037805591 8:22056527-22056549 CTGTTTAGGAGGAGGCTGAGGGG + Intronic
1039600090 8:38829268-38829290 GGGATGAGAAGGAGGCCAGGGGG - Intronic
1039883165 8:41639408-41639430 GTCCTGGGAATGAGGCTAAGAGG - Intergenic
1039920675 8:41892196-41892218 GGGTTGACAAGGAGGCTTGGTGG - Intronic
1040869467 8:52085645-52085667 GTGTTAAAAAGGAGACTCAGAGG + Intergenic
1041166536 8:55098013-55098035 TTGTAGAGCAGGAGGCTGAGTGG + Intergenic
1041442895 8:57917435-57917457 CTGTTGAGAAGGAGGTAAAGTGG - Intergenic
1043638454 8:82416764-82416786 GTGTTGGGAATGAGGCTGAAAGG + Intergenic
1044386687 8:91597568-91597590 GTGTTGACAAGGATGCTCATAGG - Intergenic
1044808156 8:96030092-96030114 GGGATGAGAAGGAAGATAAGAGG - Intergenic
1047123064 8:121928005-121928027 GTTTTAAGGACGAGGCTAAGTGG + Intergenic
1047338074 8:123955106-123955128 GTAATGAGAAGGAGGCTTACGGG + Intronic
1047613919 8:126547295-126547317 ATGATGAGAAGCAGGCTATGTGG + Intergenic
1047765749 8:127988492-127988514 GTGTGGAGAATGAGGCCCAGGGG - Intergenic
1050339329 9:4620198-4620220 GTTATGAGAAGGAGGTTATGAGG - Intronic
1050599781 9:7238755-7238777 GTGTGAGGAGGGAGGCTAAGAGG - Intergenic
1053295902 9:36912765-36912787 TTGTGGAGAAGGAGGCTTGGAGG - Intronic
1053576842 9:39362812-39362834 GAATTGAAAAGGAGGCAAAGTGG + Intergenic
1053841355 9:42190737-42190759 GAATTGAAAAGGAGGCAAAGTGG + Intergenic
1054098412 9:60921503-60921525 GAATTGAAAAGGAGGCAAAGTGG + Intergenic
1054587941 9:66985429-66985451 GAATTGAAAAGGAGGCAAAGTGG - Intergenic
1054773504 9:69105232-69105254 GTGTTGAGAAGAAAGGAAAGAGG - Intergenic
1055018678 9:71646046-71646068 TTGTGGAGAAGGAGACTGAGGGG - Intergenic
1056057742 9:82845217-82845239 GCATTGAGAAGGAGGAAAAGTGG - Intergenic
1056926122 9:90835785-90835807 GTGTCCAGATGGAGGCTAACAGG - Intronic
1059389183 9:113988177-113988199 GGGTTGTGTGGGAGGCTAAGGGG + Intronic
1060543878 9:124449444-124449466 GTTTTGACAAGAATGCTAAGTGG + Intergenic
1060801014 9:126545953-126545975 GTGGTGAGGAGGATGCTAAGAGG - Intergenic
1060825746 9:126686986-126687008 GTGGTGAGAAGGAGGCACAGTGG + Intronic
1187489028 X:19732708-19732730 GTTTTCAGAAGGTGGATAAGTGG - Intronic
1190116695 X:47629984-47630006 GAGTAGAGAAGGAGGCAGAGGGG - Intronic
1190597225 X:52061968-52061990 GTGTCGAGAAGGAATCTGAGAGG + Exonic
1190611599 X:52192105-52192127 GTGTCGAGAAGGAATCTGAGAGG - Exonic
1190723439 X:53170979-53171001 GTGATGAGAAGGATGGGAAGGGG - Intergenic
1191641128 X:63430598-63430620 GGGAGGAGAGGGAGGCTAAGAGG + Intergenic
1192430598 X:71109008-71109030 GGATTGAGAAGGAGGCTGAGGGG - Intronic
1193151572 X:78129902-78129924 GTGAGGAGAACAAGGCTAAGAGG + Exonic
1194223252 X:91222992-91223014 GAGTTGTGGAGGAGGCTAAAAGG + Intergenic
1194939415 X:99991699-99991721 GAGTTGAGGAGGAGGGTTAGAGG + Intergenic
1195516627 X:105784212-105784234 ATGTTCACAAGGAGACTAAGTGG + Intergenic
1196983275 X:121239210-121239232 TGTTTGAGAAGGAGGCTTAGTGG + Intergenic
1197152786 X:123238314-123238336 GAGTTCAGATGGAGGCTCAGAGG + Intronic
1198010719 X:132550877-132550899 ATGATGAGAAGGATGCTATGTGG + Intergenic
1198523037 X:137471989-137472011 ATCTTGAAAAGCAGGCTAAGTGG + Intergenic
1200310521 X:155072145-155072167 GTGTTGAGGAGGGGCCGAAGAGG + Intronic
1201575906 Y:15461116-15461138 GAGTTGAGGAGGAGGTTAGGAGG - Intergenic