ID: 984744681

View in Genome Browser
Species Human (GRCh38)
Location 4:183202811-183202833
Sequence TGCTCTCTGGAGTCAAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984744677_984744681 -4 Left 984744677 4:183202792-183202814 CCTTAGTTCTAGACACAGATGCT 0: 1
1: 0
2: 1
3: 11
4: 135
Right 984744681 4:183202811-183202833 TGCTCTCTGGAGTCAAGGCTGGG 0: 1
1: 0
2: 1
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984744681 Original CRISPR TGCTCTCTGGAGTCAAGGCT GGG Intronic
900102212 1:966687-966709 TCCTCTCTGGGGACAAGGCAAGG - Exonic
900206195 1:1432876-1432898 TGCTCACTGGGGTCAAGGACAGG - Intergenic
900472061 1:2859867-2859889 TGGGCTCTGGCCTCAAGGCTTGG + Intergenic
900515659 1:3081068-3081090 GGCTCTCTGGTTTCATGGCTGGG + Intronic
901028273 1:6290833-6290855 TGCTCTCTGAAGTCAGGGTCCGG + Intronic
901394497 1:8971228-8971250 TGCTCTCTCTAGCCAAGACTAGG - Intronic
901680703 1:10911071-10911093 TGCTTTGTGGAGTGAAGGCCAGG + Intergenic
902532127 1:17097306-17097328 TGATCTCTGGACTCTGGGCTTGG - Intronic
902651578 1:17841050-17841072 TGCTCTCTGGGGTCAGAGGTAGG + Intergenic
903798837 1:25951356-25951378 GGATCTCTGGAGTCATGGCCAGG + Intergenic
903852761 1:26318159-26318181 TGCTCTCAGGAGAGAAGGCTGGG - Exonic
905451601 1:38060449-38060471 TGCTCTCTGCAATCAAGGCCTGG + Intergenic
911053823 1:93694389-93694411 AGCACTCTGGAGTCATGACTGGG - Intronic
912305689 1:108564236-108564258 TGCTATCTGTATTCAAGGTTGGG + Intronic
915591667 1:156874434-156874456 TGGTCTCTGGAGCTGAGGCTGGG + Intronic
915915117 1:159936375-159936397 TGCTCTCTGGCGGGAGGGCTGGG - Intronic
916829466 1:168476088-168476110 TCCTTTCTGCAGTCAAAGCTAGG - Intergenic
918065388 1:181097309-181097331 TGCTCTCTGCAGTGCAGGCTAGG - Intergenic
918308749 1:183270446-183270468 CACTCTCTGGAGGAAAGGCTGGG + Intronic
921627177 1:217389648-217389670 CGCCCTCTGGAGCCAAGGCCAGG + Intergenic
923513446 1:234673651-234673673 TGGCCTCTGGACTCAAGTCTTGG - Intergenic
923590441 1:235313441-235313463 TCCTCTCTGGAGTAGAGACTCGG + Intronic
1063111150 10:3038520-3038542 TGCTCTCTGGTTCCAAGGCCAGG - Intergenic
1063385777 10:5615712-5615734 GCCTCTCTGGTGTCCAGGCTTGG + Intergenic
1063706755 10:8438223-8438245 AGCTCTCTGCAGGCAAGGCTAGG + Intergenic
1065121854 10:22538182-22538204 TTCTCTCTGCATTCAAGCCTGGG - Intronic
1067048668 10:42999945-42999967 TGCTCCCTGGAGTCCATCCTGGG + Intergenic
1067355027 10:45516263-45516285 TGATCTCTTGTGTCTAGGCTGGG - Intronic
1067990767 10:51209354-51209376 TGTTCACTGGATTCAAGCCTGGG - Intronic
1068776467 10:60873195-60873217 TTCTCTCTGAAAACAAGGCTGGG + Intronic
1069626765 10:69872982-69873004 TGCTCTGTGGAGTCTAGCCTGGG + Intronic
1070742887 10:78914017-78914039 AGCTCCCGGGAGTCCAGGCTGGG - Intergenic
1071587545 10:86839713-86839735 TGCTCACTGCAGTCCAGCCTGGG - Intronic
1072734082 10:97867409-97867431 AGCTCTCTGGAGTCAAAGAGAGG + Exonic
1073006673 10:100330177-100330199 TGCTCTCTGCTGGCTAGGCTGGG - Exonic
1073353790 10:102837689-102837711 TGGGCTCAGGAGTCAAGGCTTGG + Intergenic
1073429259 10:103475777-103475799 TGGAATCTGGAGTCTAGGCTGGG + Intronic
1073463121 10:103677909-103677931 TGCCCTCTCTAGTCCAGGCTTGG + Intronic
1075337495 10:121618631-121618653 TGCTTTCTAAAGTCAAGTCTTGG - Intergenic
1076589748 10:131574882-131574904 TGCTCTGCTGAGTCAAGGTTGGG + Intergenic
1076616510 10:131758835-131758857 TGCTCTCCGGGGCCAGGGCTGGG - Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078069531 11:8099110-8099132 GGCTCTCTGCAGTCCAGGCCAGG + Intronic
1078225991 11:9391973-9391995 AGCACTTGGGAGTCAAGGCTGGG - Intronic
1079439810 11:20500043-20500065 GGCTATCTGGATTCCAGGCTGGG - Intronic
1080131590 11:28801881-28801903 TGCCCTCTGGACTCAAGGCATGG + Intergenic
1080194464 11:29592693-29592715 TGCCCTCTGGAATCAATGATTGG + Intergenic
1081573103 11:44303561-44303583 GGCTCTGAGGAGCCAAGGCTGGG - Intronic
1083651339 11:64206579-64206601 TGCTCTCTGGGGACAAAGGTGGG + Intergenic
1084664923 11:70571156-70571178 TCCACTCTGGGGTCAAGGCTGGG + Intronic
1085293935 11:75420112-75420134 TGCTCTCAGGATTCATGGCCTGG + Intronic
1088455844 11:110032316-110032338 TGTTCTCTGGATTCAATGCACGG + Intergenic
1088758638 11:112908342-112908364 TGGTGCCTCGAGTCAAGGCTGGG - Intergenic
1089087583 11:115836351-115836373 TGCTCTCTGGGGGCTATGCTCGG + Intergenic
1089412797 11:118260948-118260970 TCCTTCATGGAGTCAAGGCTGGG - Intronic
1089413134 11:118264162-118264184 CGGTCTCTGGGGCCAAGGCTGGG - Exonic
1089644142 11:119866859-119866881 TGCTCTCTGAACAAAAGGCTGGG - Intergenic
1092054147 12:5494886-5494908 TGTTCTCTGAAGTCAGTGCTCGG - Exonic
1092157679 12:6295062-6295084 AGATCTCTGCAGTCAGGGCTGGG - Intergenic
1094283832 12:28770071-28770093 TTATCTTTGGAGACAAGGCTGGG + Intergenic
1094375258 12:29783166-29783188 TTCTCTCTCGAGGCAGGGCTGGG - Intronic
1095344116 12:41129005-41129027 TGCAATCTTGAGTAAAGGCTGGG - Intergenic
1096084058 12:48853341-48853363 TTCTCTCTGGAGTAGAAGCTGGG - Intergenic
1096748945 12:53746702-53746724 TGCTGTCTGGAATCCAGGCAAGG - Intergenic
1096995843 12:55837669-55837691 TGCTCTCAGGAGACAAGGTGTGG - Exonic
1097035599 12:56121627-56121649 TGATCTCTGGGGTCAAGTGTGGG - Exonic
1098895061 12:76050235-76050257 AGCTCTGTGAAGTCAAGGCAAGG + Intronic
1100313905 12:93425674-93425696 TGCTCTTTGCAGTCACTGCTTGG - Intronic
1101317068 12:103638998-103639020 TTCTCTTTGGAGGCAAGGTTGGG - Intronic
1102235418 12:111291471-111291493 TGCCCACTGGGGTCAAAGCTGGG - Exonic
1102965035 12:117119148-117119170 TGCTGGCTGGAAGCAAGGCTGGG + Intergenic
1103601756 12:122058928-122058950 AACTCTCTGGAGTCCACGCTTGG + Intronic
1104107256 12:125674768-125674790 TGGTTTCTGGCATCAAGGCTGGG - Intergenic
1104926620 12:132317217-132317239 TGCTCTGTGGAGTCTAGGATGGG - Intronic
1105485950 13:20832799-20832821 TACTATTTGGAGGCAAGGCTTGG - Intronic
1107368325 13:39711463-39711485 TGACCTTTGGAGTCAATGCTTGG + Intronic
1109561189 13:64052531-64052553 TGCTCACTGGAGTAGAGCCTCGG - Intergenic
1113720355 13:112551550-112551572 TGCTGTTTGGAGTCATTGCTTGG - Intronic
1122694434 14:103545899-103545921 TGCTCTCAGAAGGCAGGGCTGGG + Intergenic
1122755263 14:103973609-103973631 TGCTCCCTGCATTCCAGGCTTGG + Intronic
1122780199 14:104140234-104140256 GGCTCTCTGGAGTCTCGGCGAGG + Intronic
1122956653 14:105074456-105074478 GGCTCTCTGGGGTAAGGGCTTGG + Intergenic
1129448316 15:75634300-75634322 AGCTTTCTGGAGCCAGGGCTGGG + Intergenic
1130349378 15:83077669-83077691 TGCTTTCTGGAATCCAGCCTAGG + Intergenic
1130862665 15:87904793-87904815 TGCTCTGTGGAGTCCCAGCTGGG - Intronic
1132025224 15:98399451-98399473 TGGTATCGTGAGTCAAGGCTGGG + Intergenic
1132576375 16:666229-666251 TCCTCTCTGGAGACAAGGATGGG + Exonic
1132691631 16:1184216-1184238 TGCTCCCTGGTCTCAGGGCTCGG - Intronic
1133052067 16:3122793-3122815 AGGTCTCTGGAATCTAGGCTAGG + Intergenic
1133737123 16:8624413-8624435 TGCACTCTGCACTCCAGGCTGGG - Intronic
1137560575 16:49499609-49499631 TGCTCTATGGAGCCGAGGCGGGG + Intronic
1141015600 16:80446341-80446363 TGCTCTGTTGAGACAGGGCTAGG + Intergenic
1141719058 16:85745195-85745217 TTCTCTCTGGTGACAAGGATGGG + Intronic
1142380680 16:89730278-89730300 TGTTCCCAGGAGTCATGGCTGGG + Intronic
1143258509 17:5581915-5581937 TGCTCTCTGGGTGCTAGGCTGGG + Exonic
1144046968 17:11462661-11462683 TGCACTCTGGACTCCAGCCTGGG - Intronic
1144125653 17:12200321-12200343 AGCTGTCTGGAGTTCAGGCTGGG + Intergenic
1144574476 17:16420257-16420279 TGCCCTGTGGATCCAAGGCTAGG + Intronic
1144661464 17:17073499-17073521 TGGCCTCTGGAGGCAGGGCTTGG - Intronic
1146260010 17:31414982-31415004 TGCCCTCTTGGGTCAACGCTGGG - Intronic
1146286517 17:31577779-31577801 TGCCCACTGGAGCCAGGGCTGGG - Intergenic
1146574683 17:33980692-33980714 AGCTCTCTGCAGTCAGGGTTAGG - Intronic
1146661433 17:34667586-34667608 GGGTCTCAAGAGTCAAGGCTGGG - Intergenic
1150507094 17:65710154-65710176 TCCTCTCTGGTGTCAGTGCTAGG + Intronic
1150824223 17:68460448-68460470 TGCTTACTGGAATCAAGGTTTGG + Intergenic
1150900838 17:69275277-69275299 TGCTCTCAGGAGGCAAAGCAAGG + Intronic
1151817061 17:76476574-76476596 TGCTGTCTGGGAGCAAGGCTGGG + Intronic
1152880115 17:82809601-82809623 TGGTCTCTGGAGGAAAGGATGGG + Intronic
1153812915 18:8767340-8767362 TGCTATCTGGAGCCACTGCTTGG - Intronic
1156830948 18:41490528-41490550 TTGACTCTGGAGTCAAAGCTGGG - Intergenic
1157117571 18:44876406-44876428 TCCTGTCTGCAGCCAAGGCTGGG - Intronic
1158183688 18:54747126-54747148 TGCTCTATGGAGAGTAGGCTGGG - Intronic
1160756170 19:758100-758122 GGCTCTCCGGAGTCCGGGCTGGG - Exonic
1162536482 19:11265495-11265517 GGCTCCCTGGAGTCAAATCTTGG - Intergenic
1163003636 19:14384132-14384154 TCCTCTCTGGCCACAAGGCTTGG - Intronic
1163568281 19:18064821-18064843 TGGACTCTGGAGGCAGGGCTTGG + Intronic
1164078361 19:21841468-21841490 TTCTCTCTGCAGGCAAGGCCTGG + Intronic
1164232885 19:23306643-23306665 TGCTCTCTGTAGGCAGGGCCAGG - Intronic
1165149246 19:33751237-33751259 TGTTCTCAGGATTCACGGCTTGG + Intronic
1166850370 19:45757246-45757268 TGTTCTCTGGGGTCCAGGCAGGG - Exonic
1168689384 19:58367725-58367747 GGCTCCCTGCAGTCAAGGCGCGG + Exonic
925388111 2:3477070-3477092 TGGCCTCAGGAGTCAGGGCTGGG + Intronic
925628239 2:5863313-5863335 TGCTCTGTGAAGGCAAGGCAAGG - Intergenic
926134046 2:10324361-10324383 AGTTCTCTGGAGTCAGGTCTGGG + Intronic
926412079 2:12614999-12615021 TTGACTCTGGAGTCAGGGCTTGG - Intergenic
927054699 2:19357703-19357725 TGCTCTGTGTCGTCAAGGCCTGG - Intronic
928369538 2:30731273-30731295 TGCCCTCTGGAATCAAGTCAGGG + Intronic
930111786 2:47685013-47685035 TTCTCTTTGGTTTCAAGGCTGGG - Intergenic
930688053 2:54330401-54330423 AGCTTTCTGGAGTAAAGGCTAGG + Intronic
933285678 2:80382140-80382162 CGATCTTTGGAGACAAGGCTAGG - Intronic
933519728 2:83355105-83355127 TACTCACTTGAGTCAAGCCTTGG + Intergenic
933744682 2:85561807-85561829 TGCTCTCTGGTGTGAGGGATCGG + Intronic
934891216 2:98071221-98071243 TGCTCTGTGTATTCAAGACTAGG - Intergenic
935232329 2:101109735-101109757 TGGGCTCTGGAGCCAGGGCTGGG - Intronic
937305671 2:120869026-120869048 TGCTTTCTGGAGACAGGACTGGG + Intronic
939227453 2:139382126-139382148 TTATCTCTGGAGGCACGGCTTGG - Intergenic
941978611 2:171431906-171431928 TGGGCTCTGGAGTCCAGACTAGG - Intronic
942507376 2:176657230-176657252 TGATCTCTGCAGTCAGGACTTGG - Intergenic
942612665 2:177757996-177758018 TTCTCTGTGGAGGCAAGGCACGG + Intronic
944668121 2:201973278-201973300 TGGTCTTTGGAATGAAGGCTGGG + Intergenic
945980949 2:216310175-216310197 TCATCACTGGAGTCAAGGCTAGG - Intronic
946685675 2:222267164-222267186 TGCTATGAGGAGTGAAGGCTGGG - Intronic
947517660 2:230821563-230821585 TATTCTCTGGAGTGAAGGCAAGG + Intergenic
948198398 2:236112123-236112145 AGCTCTCTGGAGGCCAGGCGTGG + Intronic
948617812 2:239212720-239212742 TCCTCCCTGGAGTCCAGGCCTGG - Intronic
948672941 2:239580098-239580120 TGCTCTCTGCACTCCAGCCTGGG + Intronic
1170536966 20:17349932-17349954 TGCACTGTGCAGTCAAGGCTGGG + Intronic
1171962992 20:31508582-31508604 TGCTCTCTGGAGCCCCAGCTGGG + Intergenic
1172975705 20:38904189-38904211 TTCTGTCTGAAGTCAAGGCCAGG + Intronic
1173671549 20:44802576-44802598 GGCACTGTGGAGTCCAGGCTGGG - Intronic
1173971969 20:47160144-47160166 TGCTGGCTGGAGACTAGGCTGGG + Intronic
1174062861 20:47844842-47844864 TTCTCTGTGGAGGCAGGGCTAGG - Intergenic
1174151214 20:48487838-48487860 TTCTCTGTGGAGGCAGGGCTAGG - Intergenic
1175548768 20:59802022-59802044 TGGTCGCTGGAGTCAGGCCTTGG + Intronic
1175852595 20:62101801-62101823 TGCTCTCAGGAGTCAGGGCTGGG - Intergenic
1176129592 20:63491058-63491080 TGCTCTCCGGGGGCAAGGATGGG - Intronic
1176137503 20:63530614-63530636 TGCCCTCGGGAGCCCAGGCTGGG - Intronic
1177656713 21:24026242-24026264 TGGTCTCTGGAATCTAGTCTGGG - Intergenic
1181364255 22:22362961-22362983 TCCTCACAGGATTCAAGGCTTGG + Intergenic
1181462251 22:23092730-23092752 TGCTCCCTGGCTCCAAGGCTGGG - Intronic
1181776704 22:25165357-25165379 TGGTCTCTGGATTCAAGTCCAGG + Intronic
1181922153 22:26328830-26328852 GCCTCTCTGAAGTCAGGGCTGGG + Intronic
1182172010 22:28240572-28240594 TCCTCTCTGGAGACTAAGCTAGG - Intronic
950974866 3:17229749-17229771 CGGGCTCTGGAGTCAAGCCTGGG - Intronic
952826024 3:37525917-37525939 GGCTCTCCGGCCTCAAGGCTGGG + Intronic
952989175 3:38816619-38816641 CGCTCTCTGGGGTCAATGATAGG - Intergenic
953147795 3:40294766-40294788 AACTCTCTGGAATCAAGGTTAGG + Intergenic
954698568 3:52440244-52440266 GGCCCTCTGGAGCCCAGGCTTGG + Intronic
955087532 3:55717795-55717817 AGCCATCTGAAGTCAAGGCTTGG - Intronic
957282979 3:78177607-78177629 TGGTGTTTTGAGTCAAGGCTTGG - Intergenic
959571854 3:107893310-107893332 TCCTATCTGGAGCCAAGGCGGGG - Intergenic
961462229 3:127058291-127058313 TGCTCTCTGGAGGAACAGCTTGG - Intergenic
961524452 3:127487671-127487693 TGCTCTCTGGTGGCAAGGGAGGG - Intergenic
962221506 3:133568184-133568206 TGCTTTCTAGAGTCAAATCTAGG - Intergenic
963973701 3:151457558-151457580 TGGGCTCTGGAGGCCAGGCTTGG + Intronic
965612311 3:170557331-170557353 TGCTTTCTGGAGACCAGGCTCGG - Intronic
965710846 3:171555041-171555063 TGCACTCTGCAGTCCAGCCTGGG + Intergenic
967137795 3:186527209-186527231 TGGTTTCTGGACTCAAGGCTAGG - Intergenic
967888144 3:194346992-194347014 TGCTTTCTTGAGGCCAGGCTGGG - Intronic
969192585 4:5534123-5534145 TGCTCTGTGGAGAAAAGACTGGG + Intergenic
969492825 4:7509729-7509751 TGGGCTCTGGAGAGAAGGCTGGG + Intronic
970203171 4:13629754-13629776 TACTATATGCAGTCAAGGCTGGG + Intergenic
976597550 4:86908060-86908082 TGCTCTCTGCAGGCAAAGCAAGG - Intronic
978373155 4:108049541-108049563 TGCTCTCTGGAGTGAAGGAACGG - Intronic
981468584 4:145102245-145102267 TGCTCTCTGGAATCCATTCTAGG - Intronic
984744681 4:183202811-183202833 TGCTCTCTGGAGTCAAGGCTGGG + Intronic
988900191 5:35723134-35723156 TGCTCACTGGGGTGAAGCCTTGG - Intronic
992473453 5:77080133-77080155 TGCTTTCTTGAGCCAAAGCTTGG + Intronic
993226999 5:85179861-85179883 TGATCTCTAGAGTCAGTGCTAGG + Intergenic
993443790 5:87987995-87988017 AGCTGTCTGAATTCAAGGCTTGG - Intergenic
994298594 5:98119930-98119952 TGCTCTCTCGATTCTAGCCTTGG - Intergenic
995585280 5:113642381-113642403 GGCCCTCTTGAGTCATGGCTGGG - Intergenic
995841103 5:116444050-116444072 TACTCTCGGGAGTCAAGCATGGG + Exonic
996417598 5:123227180-123227202 TGCTCTCAGGACTAAAGGCAAGG + Intergenic
997641275 5:135450421-135450443 TGCTCCCAAGAGTCAGGGCTCGG - Intronic
997926337 5:138033571-138033593 TTCTCTCTGGAGTCTAGGTCAGG - Intronic
998045042 5:138980306-138980328 TCCTCTCGGCAGTCAAGTCTAGG - Intronic
999435171 5:151557972-151557994 AGCTTCCTGGAGTCAAGGCGAGG - Intronic
1000173336 5:158725773-158725795 TGCTCTCTGGGTTCAAGGTTTGG + Intronic
1000506841 5:162130930-162130952 AGCTCTCTTGAATCAAGGCATGG - Intronic
1002852413 6:1008176-1008198 TGCTATCTGGGCTCAGGGCTGGG + Intergenic
1004486593 6:16072317-16072339 TGCAATGTGGAGTCAAGGTTGGG - Intergenic
1007717897 6:43867863-43867885 AGGGCTCTGGAGTCATGGCTGGG - Intergenic
1010382829 6:75243989-75244011 TGGTCCCTGGAGCTAAGGCTGGG + Intronic
1012658675 6:101858428-101858450 TGCTCACTGCACTCAAGTCTGGG - Intronic
1012872350 6:104687158-104687180 TTCTCTCTGGGGCCAAGGCAGGG + Intergenic
1013152434 6:107459451-107459473 TGCTTTCTGCAGCCCAGGCTGGG + Exonic
1015712683 6:136159398-136159420 TGCTGTCTGCAGGGAAGGCTGGG - Intronic
1017566294 6:155691104-155691126 TGATCTCTGGATTCAGGCCTAGG + Intergenic
1018102834 6:160456587-160456609 TGGGCTCTGGGGTCAAGGCCCGG + Intergenic
1019261564 7:84680-84702 TGCCCACTGGAGCCAAGGCCTGG + Intergenic
1019355407 7:576246-576268 TGCACGCTGGAATCACGGCTGGG + Intronic
1019902058 7:4028664-4028686 AGCTCTCTGGAGGACAGGCTGGG + Intronic
1020510404 7:9049571-9049593 TGCTCTCTCTAGTCAAGGAGAGG + Intergenic
1021961402 7:25876694-25876716 GGTTCTCTGGAGTCTAGACTCGG + Intergenic
1024264114 7:47593666-47593688 TGCTCTCCGGAGCCAAGGGAGGG - Intergenic
1024505756 7:50159746-50159768 TGCTCTCTTTGGTCAAGGCCGGG - Exonic
1026475949 7:70735431-70735453 TGGCTTCTAGAGTCAAGGCTGGG + Intronic
1027127411 7:75566661-75566683 TGGACTCTGGAGGCAGGGCTTGG - Intronic
1032177814 7:129647003-129647025 AGCTCACTGAAGTCAGGGCTCGG - Intronic
1032741686 7:134746067-134746089 TGCCTTCAGGAGTCAAAGCTTGG + Intronic
1033003862 7:137538905-137538927 TGCTGCCTGGAGTCCAGGCTGGG - Intronic
1033243393 7:139699574-139699596 TGCTATCAGGAGGCAAGGCTGGG + Intronic
1033547257 7:142412873-142412895 GGCTGTCTGGAATGAAGGCTGGG + Intergenic
1034125121 7:148664433-148664455 TTCTCTCTGGAGACCGGGCTGGG - Intergenic
1034269277 7:149795816-149795838 TGCTCTGTGGAGCCGAGGCTTGG + Intergenic
1035649319 8:1253123-1253145 TGCTCTTTGCATTCATGGCTGGG + Intergenic
1036963195 8:13268676-13268698 TTCTCTCTGCAAACAAGGCTGGG - Intronic
1037732004 8:21533945-21533967 GTCTCTCTTGAGTCAATGCTTGG - Intergenic
1042258606 8:66833039-66833061 TGCACTCTGCACTCCAGGCTGGG - Intronic
1045843809 8:106609606-106609628 TGCTCTCTGGAGTCATTATTGGG + Intronic
1045976967 8:108140098-108140120 AGTTCTCTGGAGCCCAGGCTTGG + Intergenic
1048492097 8:134903152-134903174 TCCTCTGTAGAGACAAGGCTTGG - Intergenic
1048923541 8:139251489-139251511 TGCACTTTGGAGGCAAAGCTGGG - Intergenic
1049808205 8:144550902-144550924 TGCTCTGTGGCTGCAAGGCTTGG + Intronic
1053208132 9:36205302-36205324 TGCTCTCTGGTGTGCAGGCTGGG + Intronic
1053313676 9:37035202-37035224 TCCTCTCTGGAATCAAGTCCTGG - Intergenic
1056446466 9:86671097-86671119 TTCTCTCTGGAGTAAAGGGAGGG + Intergenic
1056978925 9:91289445-91289467 TGCACTCTGCAGGGAAGGCTTGG - Intronic
1057839508 9:98474485-98474507 TGCTCTCTGTAGTCACTTCTGGG - Intronic
1060852499 9:126889318-126889340 TTTTCCCTGGAGTCCAGGCTTGG + Intergenic
1061307165 9:129738762-129738784 TTCTCTGTGGAAGCAAGGCTGGG - Exonic
1062122717 9:134842310-134842332 TGCTCTCGGGAGCCCGGGCTCGG - Exonic
1186584691 X:10860124-10860146 TGCACTCTGTAGTGAAGACTGGG + Intergenic
1190054393 X:47173434-47173456 TGCTCCCTGGGGTCAGGGCCAGG + Intronic
1190131950 X:47756149-47756171 TACTTTCTGGAGTCAAGTCCAGG - Intergenic
1192209424 X:69118288-69118310 TTCTCTTTGGAATCAAGGCGTGG + Intergenic
1192363477 X:70453344-70453366 TGGTCTCTGGAGTTCAGGGTAGG + Intronic
1193098393 X:77579163-77579185 TGCTTTCTGGAGCCAGGGCCTGG - Intronic
1193950959 X:87797668-87797690 TAGTCTGTGTAGTCAAGGCTAGG - Intergenic
1195427300 X:104748747-104748769 TGCTCTCTGAATTCTAAGCTGGG - Intronic
1196765182 X:119236342-119236364 TGATCTCTGGAGTAAAGGTTGGG - Exonic
1199466588 X:148144831-148144853 GACTCTCTGGAGTCAAGGGCTGG - Intergenic
1199850279 X:151721266-151721288 TGGTCTCTGGAATCAAGGGCTGG - Intronic
1199894240 X:152116495-152116517 TGCTCTCTGGAGTGACAGCAGGG + Intergenic
1200124836 X:153808297-153808319 TCCTCTCTGGAGGCAGGGCCCGG + Intronic
1200788783 Y:7281613-7281635 TTCACTCTGTAGTGAAGGCTAGG + Intergenic
1201896172 Y:18994737-18994759 TGCTCTCTAGCTTCAGGGCTTGG - Intergenic