ID: 984744744

View in Genome Browser
Species Human (GRCh38)
Location 4:183203482-183203504
Sequence GAGTGGATACAGAAGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984744744_984744749 0 Left 984744744 4:183203482-183203504 CCATAGTCCTTCTGTATCCACTC 0: 1
1: 0
2: 0
3: 28
4: 288
Right 984744749 4:183203505-183203527 CTTTCATTTCCAGTGTGGCCTGG 0: 1
1: 0
2: 0
3: 27
4: 225
984744744_984744750 1 Left 984744744 4:183203482-183203504 CCATAGTCCTTCTGTATCCACTC 0: 1
1: 0
2: 0
3: 28
4: 288
Right 984744750 4:183203506-183203528 TTTCATTTCCAGTGTGGCCTGGG 0: 1
1: 1
2: 5
3: 36
4: 410
984744744_984744747 -5 Left 984744744 4:183203482-183203504 CCATAGTCCTTCTGTATCCACTC 0: 1
1: 0
2: 0
3: 28
4: 288
Right 984744747 4:183203500-183203522 CACTCCTTTCATTTCCAGTGTGG 0: 1
1: 1
2: 0
3: 31
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984744744 Original CRISPR GAGTGGATACAGAAGGACTA TGG (reversed) Intronic
900376743 1:2358289-2358311 GAGTGGAGACATCAGGACTCCGG - Intronic
901707155 1:11082829-11082851 GAATGGCTACAGAAAGACTTTGG - Exonic
902645181 1:17792897-17792919 GAGTGGAGACAGGAGGACATAGG + Intronic
903313055 1:22475597-22475619 GAGTGGCAAGGGAAGGACTAGGG - Intronic
904083266 1:27885476-27885498 GAGGGGAGACACAAGGACAAGGG - Intronic
904741476 1:32679677-32679699 GCGTGGATCCAGAAGGACAAGGG + Exonic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
906021224 1:42631452-42631474 GAGTGGTTACAGCAGGACTTGGG - Intronic
906558511 1:46735376-46735398 GAGTGGAAATGGAAGGACAAGGG + Intergenic
907422570 1:54357133-54357155 GAGAGGAGACAGAAGGCCAAAGG + Intronic
909182224 1:72439294-72439316 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
909431387 1:75590965-75590987 GAGTAGTTACAGCAGGACTTTGG + Intronic
910240181 1:85078137-85078159 GAGTGGACACAGAAGATCCATGG - Intronic
910787688 1:91018462-91018484 GAGTGGATACTGTAATACTATGG - Intronic
911373764 1:97025153-97025175 GAGTGGTTACAGTAGGCCTTGGG + Intergenic
911466599 1:98262207-98262229 GAGTGAATTTAGAAGGACGATGG + Intergenic
912598643 1:110904297-110904319 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
912891915 1:113542281-113542303 GAGATGATACAGCAGGACAAAGG + Intronic
912956896 1:114160646-114160668 TATTGGATTCAGAAGGTCTAGGG - Intergenic
915730310 1:158049071-158049093 GTGTGGAGACAGAACGAATAAGG + Intronic
917003258 1:170384916-170384938 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
917583873 1:176405451-176405473 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
918297647 1:183171997-183172019 GAGAGGACACAGAATGACTTTGG + Intergenic
918666123 1:187153960-187153982 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
918715378 1:187779799-187779821 GAGTGGTTAGAGAAGTATTAAGG - Intergenic
919424871 1:197417496-197417518 GAGTTGATAAAGAAGGAAGAAGG + Intronic
922320394 1:224481727-224481749 TAGTGGTTACAGCAGGCCTAGGG - Intronic
922682235 1:227610115-227610137 GAGTTTATACAGAAGACCTAGGG + Intronic
923469134 1:234274741-234274763 GACTAGATAGACAAGGACTAGGG - Intronic
924649004 1:245905735-245905757 GAGTGGTTACAGCAGGTCTTGGG + Intronic
1064932559 10:20643292-20643314 GAGGGGATACTTGAGGACTAAGG - Intergenic
1069717218 10:70529080-70529102 GAGTGGATATTGAGGGACAATGG + Intronic
1069933468 10:71899543-71899565 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1071046727 10:81387893-81387915 GAGTGGTTACAGCAGGTCTTGGG + Intergenic
1072058888 10:91788696-91788718 GAGTAGATACAGCAGGCCTTGGG + Intergenic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1079038036 11:17037448-17037470 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1079272185 11:18999276-18999298 GAGTGGCTACAGCAGGCCTTTGG - Intergenic
1079823302 11:25159581-25159603 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1082214046 11:49545355-49545377 GAGAGGATAAAGAATAACTAAGG + Intergenic
1084933539 11:72575148-72575170 GAGAGGATAGAGACGGACTTGGG + Intergenic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1086007092 11:82049384-82049406 GAGTGGTTACAGAAGGCCTTGGG + Intergenic
1086635556 11:89079136-89079158 GAGAGGATAAAGAATAACTAAGG - Intergenic
1089208665 11:116785990-116786012 GAGTGGAAACAGAGTGACTCAGG + Intronic
1091844824 12:3647800-3647822 GTGAGGAAACAGAAGGACTTTGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1092992419 12:13915750-13915772 GAGTGGCTTCAGATGGACTTTGG - Intronic
1093341273 12:17977140-17977162 TAGTAGATACAGAAGGATTTTGG - Intergenic
1093993273 12:25613959-25613981 GAGAGGAGACAGAAGGACAAAGG + Intronic
1095573527 12:43709458-43709480 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1097224291 12:57467959-57467981 GAGTGGAGACAGAAGGCAAACGG - Intronic
1098619544 12:72577516-72577538 CAGAGGATATAGAAGGACTGAGG + Intronic
1099524867 12:83706362-83706384 GAGTGGTTACAGCAGGTCTTGGG + Intergenic
1101120378 12:101573170-101573192 GAGTGGTTACTGAGGGAGTAGGG + Intronic
1102699453 12:114826351-114826373 CAGTGGCTACAGAAGGCCTGGGG - Intergenic
1102965287 12:117120825-117120847 GAGTGGCTCCACAATGACTAGGG - Intergenic
1105336293 13:19473182-19473204 GAGTGGTTACAGCAGGTCTTGGG - Intronic
1106645415 13:31629273-31629295 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1106896090 13:34303387-34303409 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1108922636 13:55694143-55694165 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1109826309 13:67727116-67727138 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1111636351 13:90908782-90908804 GAGTGGATAAAGAAAGATCAAGG + Intergenic
1114688043 14:24553799-24553821 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1115948751 14:38695218-38695240 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1116725073 14:48553333-48553355 GATTGGATACAGCAGGCCTTGGG - Intergenic
1117591515 14:57273458-57273480 GAGTGGAGGCAGAAGGAATGAGG + Intronic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1120026948 14:79597058-79597080 GAGTATAAAAAGAAGGACTAAGG - Intronic
1121088486 14:91164815-91164837 GAGTGGTTACAGCAGGACTTGGG - Intronic
1121759663 14:96434566-96434588 GAGTGGTTACAGCAGGCCTTGGG - Intronic
1122433001 14:101667918-101667940 GAGAAGATAAAGAAGGACTGAGG + Intergenic
1124844177 15:33274808-33274830 GAGTGGTTACAGCAGGACTTGGG - Intergenic
1125280155 15:38034600-38034622 GAATGAATAGAGAAGGTCTAAGG - Intergenic
1126885873 15:53149172-53149194 GAGTGGAAACACAAAAACTAGGG + Intergenic
1127132700 15:55883552-55883574 GAGTGGTTACAGCAGGCCTTGGG + Intronic
1127196560 15:56591931-56591953 GAGTGGTTACAGCAGGGCTTGGG + Intergenic
1127698068 15:61471215-61471237 GAGTGGACACAGAGGGCCTCAGG - Intergenic
1129325858 15:74800019-74800041 GAGTGAATACAGAGGGACACGGG - Intronic
1130086699 15:80783751-80783773 GAGAAGAAAAAGAAGGACTAGGG - Intronic
1131116248 15:89797817-89797839 GAGTGGATACAGGGGGCCTAGGG - Intronic
1133505070 16:6403715-6403737 GAGAGGACACCGAAGGACTGTGG + Intronic
1135653803 16:24229972-24229994 GAGAGGACATAGAAGGGCTAAGG - Intergenic
1138018816 16:53457615-53457637 GAGAGAATACAAGAGGACTAAGG + Intronic
1138216666 16:55210714-55210736 AGGTGAATACAGAAGGAATAAGG + Intergenic
1138399551 16:56734417-56734439 GAGTGGTAACAGAAGGAGTTGGG + Intronic
1140915231 16:79487582-79487604 GAGTGGATCCAAACGGACAACGG - Intergenic
1141161723 16:81633548-81633570 GAGATGATGCAGAACGACTAGGG + Intronic
1142285098 16:89168455-89168477 GAGTGGATCCAGAAGGGCTGGGG - Intergenic
1142901667 17:3015966-3015988 AAGCTGATGCAGAAGGACTAAGG - Intronic
1143732497 17:8888959-8888981 GAGGGGAGACAGCAGGACTCAGG + Intronic
1143814815 17:9504178-9504200 GAATGTATACAAAAGGTCTAAGG + Intronic
1145245616 17:21267405-21267427 GAGTGCATGCTGATGGACTAGGG + Intergenic
1145997770 17:29114414-29114436 GAGAGGATTCAGAAGGAAAATGG - Intronic
1148470263 17:47888900-47888922 GTGTGGGTTCAGAAGGACCAGGG - Intergenic
1148728193 17:49811750-49811772 GAGTGGAAACAGGAGGTCTTGGG + Intronic
1149906341 17:60529470-60529492 GAGTGGTTACAGCAGGTCTTGGG + Intergenic
1150247157 17:63685143-63685165 GAGTGTAAACAGAAGCATTAAGG + Intronic
1150976904 17:70097730-70097752 GAGTGGATACAGATGCAATCAGG - Intronic
1153212022 18:2777452-2777474 GAGTGGTCACAGAATGACTAGGG - Intronic
1154386685 18:13898544-13898566 GAGTGGTTACAGCAGGCCTGGGG + Intronic
1155597393 18:27503175-27503197 GAGTGTATACAGCAGGCCTTGGG + Intergenic
1157140991 18:45106197-45106219 GGCTAGATACAGAAGGAATATGG + Intergenic
1157228453 18:45890246-45890268 GAGAGCACACAGAAGGGCTACGG - Intronic
1158249793 18:55475020-55475042 AAGTGCACACAGAAGTACTAAGG - Intronic
1159174437 18:64814892-64814914 GAGTGCATTCAGAAGCACTGGGG + Intergenic
1159896396 18:74001124-74001146 GAGTGGTTACAGCAGGACTTGGG - Intergenic
1162336998 19:10067924-10067946 GTGTGGCTACAGGAGGAGTAAGG + Intergenic
1162579335 19:11518997-11519019 GAGTGGATTCTGAAGGAGTTGGG + Intronic
1162666674 19:12219678-12219700 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1165171457 19:33894863-33894885 GAGTGGATGCAGAAGGGCAGGGG - Intergenic
1165213461 19:34253490-34253512 GTGTGGAGAAGGAAGGACTACGG - Intergenic
1168096445 19:54118164-54118186 GGGTTGATAAAGAAGGACCAGGG + Intronic
925959124 2:8998740-8998762 AAGTCGACACTGAAGGACTAGGG - Intronic
928127822 2:28628444-28628466 GAGTGGGTACAGAGGGGCTTCGG - Intronic
929926456 2:46216556-46216578 GAGTGGTTACAGTAGGCCTTGGG - Intergenic
930159321 2:48138048-48138070 GAGTAGATACAGCAGGTCTTGGG + Intergenic
930727502 2:54695901-54695923 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
931912952 2:66922106-66922128 GAGAGGGGTCAGAAGGACTAAGG + Intergenic
931989033 2:67770935-67770957 GGGTCAATACAGAAGGCCTATGG + Intergenic
933387939 2:81634901-81634923 GAGTGTTTACAGCAGGACTTGGG + Intergenic
936983712 2:118288324-118288346 GAGGGGATAGAGAAGGAATGAGG + Intergenic
938217087 2:129527044-129527066 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
938619374 2:133032634-133032656 GAGTGGTTACAGCAGGTCTCGGG + Intronic
940503687 2:154526854-154526876 GAGTGGTTACAGTAGGCCTTAGG - Intergenic
940786258 2:157984720-157984742 GAGTGGTTACAGCAGGCCTTGGG - Intronic
941141534 2:161789044-161789066 GTGTGGCAACACAAGGACTAAGG + Intronic
941227761 2:162869215-162869237 GAGTGAATACAGCAGGACTTAGG + Intergenic
941302936 2:163827307-163827329 AAGTGGTTACAGAAGGCCTTGGG - Intergenic
943923394 2:193739010-193739032 GAGTGGTTACAGCAGGTCTTGGG + Intergenic
943957883 2:194216334-194216356 GCGTGGATTCAGAAGGTCAAGGG - Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947312243 2:228817658-228817680 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1168912969 20:1464820-1464842 TAGTTGATACAGAAGCACTGAGG + Intronic
1168917135 20:1499576-1499598 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1170609348 20:17899699-17899721 GAGTGGATAAAGAATGATTTAGG - Intergenic
1171938068 20:31294496-31294518 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1172871658 20:38139525-38139547 GACTGGATCCAGCAGGACGATGG - Exonic
1173602571 20:44306592-44306614 GAGGGGGGACAGAAGGACAATGG - Exonic
1174256063 20:49256099-49256121 GAGTGGCTAAACAAGGACTCTGG + Intronic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1176737257 21:10561905-10561927 GAGTGGTTACAGCAGGTCTTGGG + Intronic
1176917660 21:14645183-14645205 GAGTGGTTACAGCAGGCCTTGGG + Intronic
1177401143 21:20606374-20606396 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1178053463 21:28772782-28772804 TAGTGAATACAGAAGCAATATGG - Intergenic
1181083824 22:20430162-20430184 GAGTTGGTACAGAAGGACCAGGG - Intronic
1183531867 22:38360688-38360710 GAGTGGTTACAGCAGGTCTTGGG - Intronic
1184181772 22:42833087-42833109 GAGAGGCCACAGAAGTACTATGG + Intronic
949854316 3:8446466-8446488 GAGTGGCTACTGAATGAGTATGG - Intergenic
951032135 3:17894882-17894904 GAGTGGCTACAGCAGGCCTTGGG - Intronic
951274100 3:20664001-20664023 GAGTGGCTACAGAAGGAAAGGGG - Intergenic
951904404 3:27689279-27689301 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
952139728 3:30465592-30465614 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
952222062 3:31332770-31332792 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
952956802 3:38562644-38562666 GAGTGGACACAGGAGGCCTGTGG - Intronic
953722673 3:45369765-45369787 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
953981056 3:47413142-47413164 GAGTGGATCCAGAAGGCTGAGGG - Exonic
954959755 3:54553783-54553805 GAGTGGAAACTCAAGCACTAAGG + Intronic
955655671 3:61242512-61242534 GGGTGGTTACAAAAGGACAAGGG - Intronic
957915923 3:86687485-86687507 GAGTGGTTACAGTAGGCCTTGGG + Intergenic
958847283 3:99279499-99279521 GAGTGGTTACAGCAGGTCTTGGG + Intergenic
959724919 3:109532711-109532733 CAGTGGTTACAGCAGGACTTGGG - Intergenic
961725381 3:128924975-128924997 GAGTGCATAAAGTGGGACTAGGG - Intronic
962698912 3:137978412-137978434 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
963310188 3:143700824-143700846 GAGTGGTTACAGCAGGCCTTGGG + Intronic
963608411 3:147434550-147434572 GAGTGGAGACAGAAAGCCCATGG - Intronic
963821877 3:149905987-149906009 GAGTGGACGAAGAAGGACTGGGG - Intronic
964147542 3:153483578-153483600 GACTGGGTATAGAAGAACTAAGG - Intergenic
964976088 3:162622379-162622401 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
965026271 3:163304666-163304688 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
965308523 3:167099089-167099111 GAGTGGAAGCAAAAGGACAAAGG - Intergenic
966151775 3:176874165-176874187 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
967952419 3:194851521-194851543 GAGTGGCCACAGGAGGACTGAGG + Intergenic
969074166 4:4564083-4564105 GAGTAGGTACAGCCGGACTAGGG + Intergenic
970011093 4:11459880-11459902 GAGTGGTTACAGCAGGTCTTGGG + Intergenic
970667378 4:18353547-18353569 GAGTGGCTACAGTAGGCCTTGGG - Intergenic
971101576 4:23472281-23472303 GAGTAGATGCAGAAGGTCTCAGG + Intergenic
971891555 4:32529909-32529931 GAGTGATTACAGCAGGACTTGGG + Intergenic
972104057 4:35461097-35461119 GAGTGGTTACAGCAGGCCCAGGG - Intergenic
978661843 4:111136888-111136910 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
979219035 4:118200018-118200040 GAGTGGTTACAGCAGGGCTTGGG - Intronic
979400104 4:120238681-120238703 GAGTAGATACAGCAGGGCTGAGG + Intergenic
981298010 4:143155760-143155782 GAGTTGTTACAGCAGGACTTCGG - Intergenic
981672967 4:147308866-147308888 GAGTAAATAAAAAAGGACTAAGG + Intergenic
981701919 4:147616988-147617010 GAGTGGATACAGAAGCCCGCTGG - Intergenic
983421659 4:167526479-167526501 GAGTGGTTACAGAAGGCCTTGGG - Intergenic
984744744 4:183203482-183203504 GAGTGGATACAGAAGGACTATGG - Intronic
985930361 5:3052271-3052293 CCGTGGATACAGAAGGGCTGTGG + Intergenic
987124301 5:14797129-14797151 GCATGGATCCAGAAGGACAAGGG - Intronic
988299578 5:29404596-29404618 GAGTGGTTACAGTAGTACTTGGG + Intergenic
989722995 5:44552299-44552321 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
990923708 5:60995655-60995677 GAGTGGTTACAGCAGGCCTTGGG - Intronic
992549816 5:77849796-77849818 GAGTGGATGCGGGAGGCCTAGGG - Intronic
992632442 5:78695072-78695094 GAGAGGATCTAGAAAGACTAAGG + Intronic
994208631 5:97063326-97063348 TAGTAGATACAGAATGACTTTGG + Intergenic
994765498 5:103911046-103911068 AAGTGGATACATAAGGAATCTGG + Intergenic
996116314 5:119624108-119624130 GAGTGGTTACAGTAGGCCTTCGG - Intronic
996594587 5:125185888-125185910 GAATGGTTACAGCAGGACTTGGG + Intergenic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
996806584 5:127462319-127462341 GGGTGGATACACAAAGACAAGGG + Intronic
996927638 5:128846670-128846692 GAGTGGTTACAGCAGGCCTTGGG + Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
1000204953 5:159050090-159050112 AAGTGGATACAGGAGAACCAGGG + Intronic
1002833196 6:842755-842777 GAGTGGTTGCTGAAAGACTAGGG + Intergenic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1003921993 6:10841087-10841109 GAGTGGAGAAAGAAAGAGTAGGG + Intronic
1006628468 6:35414281-35414303 GAGTCTATACCGAAGGACTCAGG + Intronic
1007174765 6:39888136-39888158 GAGGGGATAGGGAAGGGCTATGG + Intronic
1007485801 6:42179671-42179693 GAGAGGAGTCAGAAGGGCTAGGG - Exonic
1008571845 6:52824528-52824550 GAGTAGACCCAGAAGGACTAAGG + Intergenic
1008577909 6:52879055-52879077 GATAGGAAAAAGAAGGACTAAGG - Intronic
1009771143 6:68144568-68144590 GAGTGGTTACAGTAGGCCTTGGG - Intergenic
1010139836 6:72601766-72601788 GAGTGGTTACAGTAGGCCTTGGG - Intergenic
1010528993 6:76942774-76942796 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1010858871 6:80879338-80879360 GTGTGCATAAAGAAGGACTCTGG + Intergenic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011333140 6:86233035-86233057 GAGTGGTTACAGAAGATCTGGGG - Intergenic
1012050015 6:94329213-94329235 GAGTGGTTACAGCAGGACTTGGG + Intergenic
1012620464 6:101338877-101338899 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1012679037 6:102154668-102154690 GAGTGGTTACAGCAGAACTTGGG + Intergenic
1013185133 6:107750988-107751010 GAGTGAATATAGAATGACTGGGG - Intronic
1013976726 6:116087632-116087654 GAGAAGATACAGAAGGAACAGGG + Intergenic
1014865154 6:126520731-126520753 GAGTGGTTATAGAAGGCCTTGGG - Intergenic
1015713627 6:136167816-136167838 GAGTGGATACAAAAGGAACAAGG + Intronic
1016127798 6:140427707-140427729 GAGTGGTTACAGCAGGCCTTAGG - Intergenic
1017379747 6:153814231-153814253 GAGTGGTTACAGTAGGCCTTGGG + Intergenic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017680580 6:156859813-156859835 GAGAGGGCACAGAAAGACTAAGG + Intronic
1018316660 6:162562852-162562874 GAGTGGTTACAGCAGGACTTGGG + Intronic
1019749696 7:2721220-2721242 GAGTGGAAGCACAGGGACTAAGG + Intronic
1021641083 7:22736375-22736397 GAGTGGTTACAGCAGGCCTCGGG + Intergenic
1022667230 7:32422842-32422864 GAGTGGTTGCAAAAGGGCTAGGG + Intergenic
1024020446 7:45363466-45363488 GAGAGGAAAGAGAAGAACTATGG - Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024410938 7:49039869-49039891 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1025888977 7:65628096-65628118 GATTGGATACAGTAGGGCAAAGG + Intergenic
1026299712 7:69086678-69086700 GACAGGATGCAGAAGGACCAGGG + Intergenic
1031472524 7:122183263-122183285 GAGTGGTTACAGCAGGTCTTGGG + Intergenic
1031558466 7:123207942-123207964 GTGTGGATTTGGAAGGACTAAGG + Intergenic
1031853473 7:126893873-126893895 GATTGGATACAGTAGGGCAAAGG - Intronic
1033664757 7:143429864-143429886 GAGTGGTTGCAGGAGGACTAGGG - Intergenic
1033901015 7:146140243-146140265 GAGTAGATAAAGAAGTAGTAGGG + Intronic
1034018989 7:147619849-147619871 GAGTGGTTACAGCAGGTCTTGGG + Intronic
1035375905 7:158406619-158406641 GAGTGGCTGCAGCAGGACTCAGG - Intronic
1041342570 8:56861431-56861453 AAGAGGATGGAGAAGGACTATGG + Intergenic
1041823375 8:62064057-62064079 GAGTGGTTACAGAAGGCCTTGGG + Intergenic
1043340183 8:79229072-79229094 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1044211762 8:89558969-89558991 GAGTGGATAGAGAAGGAAGTGGG - Intergenic
1049068671 8:140339627-140339649 GGCTGGATGCACAAGGACTATGG - Intronic
1049702232 8:144020544-144020566 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049702394 8:144021141-144021163 GAGAGGATACTGAAGGAAGAGGG - Intronic
1051923693 9:22298473-22298495 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1052214540 9:25950687-25950709 GAGTGGTTATAGCAGGACTTGGG - Intergenic
1056203504 9:84298898-84298920 GAGTGGCTTCAAAAGAACTATGG + Intronic
1056211151 9:84366863-84366885 AAGTGGTTACAGAAGGTCTTGGG - Intergenic
1056424588 9:86464446-86464468 GAGTGGTTACAGAAGGTCTTGGG - Intergenic
1057081790 9:92178995-92179017 GAGTGGAGACAAAAGGAAGAAGG + Intergenic
1057414327 9:94847763-94847785 CAGTGCCTACAGAAGGTCTAAGG - Intronic
1058780262 9:108325847-108325869 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1059683035 9:116604898-116604920 GAGTGGATACAGATGGCCTCTGG + Intronic
1187290519 X:17949012-17949034 GAGTGGAGACCAAAGGACTGAGG - Intergenic
1187810172 X:23167053-23167075 GTGGGGGTATAGAAGGACTATGG - Intergenic
1188046150 X:25428082-25428104 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1188210725 X:27419967-27419989 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1188715715 X:33457010-33457032 GAGTGGTTGCAGAAGGCCTTGGG + Intergenic
1188931964 X:36123261-36123283 GAGTGGTTACAGCAGGCCTTGGG - Intronic
1189220215 X:39365344-39365366 AAGTGGAGACACCAGGACTAAGG + Intergenic
1189245811 X:39562428-39562450 GACTGGGTACAGAAGGTGTAAGG + Intergenic
1189690471 X:43612594-43612616 GAGTGGTTACAGCAGAACTTTGG - Intergenic
1190050105 X:47143124-47143146 AAGTGGATAGAGAATGACTTGGG - Intronic
1190537663 X:51446088-51446110 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1191052646 X:56211504-56211526 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1192062255 X:67839399-67839421 GAGTGGTTACAGCAGGACTTGGG + Intergenic
1192714677 X:73627283-73627305 GAGTGGTTACAGAAGGCCTTGGG - Intronic
1193163449 X:78256291-78256313 GAGTGGTTACAGCAGGTCTTGGG - Intergenic
1193169152 X:78315928-78315950 GAGTGGTTACAGCAGGCCTGGGG + Intronic
1193300085 X:79879262-79879284 GAGTGGTTACAGCAGGCCTTAGG + Intergenic
1193673641 X:84419684-84419706 AAGTGGTTACAGCAGGACTTAGG + Intronic
1193683632 X:84552165-84552187 GAGTGGTTACAGTAGGCCTTGGG - Intergenic
1193915561 X:87357979-87358001 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1194791898 X:98160479-98160501 GAGTGGTTACAAAAGGCCTTGGG + Intergenic
1194839649 X:98725380-98725402 GAGTGGTTACAGCAGGACTTGGG - Intergenic
1194857768 X:98955923-98955945 GAGTGGTTACAGCAGGACTTGGG - Intergenic
1194920879 X:99761966-99761988 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1195014555 X:100765812-100765834 GAGTGGATATAGCAGGCCTTGGG - Intergenic
1195173464 X:102291873-102291895 GAATGCATACTGAAGGACCAAGG - Intergenic
1195185401 X:102395223-102395245 GAATGCATACTGAAGGACCAAGG + Intronic
1195295357 X:103471189-103471211 GAGTGAATACACAAGGAAAATGG + Intergenic
1195443987 X:104929749-104929771 AGGTGGATGCAGAAGGAATATGG - Intronic
1195559331 X:106265776-106265798 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1195594414 X:106672605-106672627 GAGTGGTTACAGCAGGCCTTGGG - Intronic
1195852066 X:109294568-109294590 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1196467904 X:115991751-115991773 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1196609663 X:117696400-117696422 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1196865460 X:120066639-120066661 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1196877634 X:120169641-120169663 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1197096768 X:122605149-122605171 GAGTTGTTACAGCAGGCCTAGGG + Intergenic
1197569242 X:128128655-128128677 GAGCAGAGAGAGAAGGACTATGG - Intergenic
1197677697 X:129347686-129347708 GAGTGGTTACAGCAGGCCTTTGG + Intergenic
1197876439 X:131114149-131114171 GAGTGGTTACAGCAGGACTTGGG - Intergenic
1197987044 X:132278108-132278130 GAGTGGTTACAGCAGGCCTTGGG - Intergenic
1198190575 X:134300104-134300126 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1198788285 X:140314403-140314425 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1198974570 X:142321866-142321888 GGGTGGAAGCAGAAGAACTAGGG - Intergenic
1199076125 X:143529288-143529310 GAGTGGTTACAGAAGGCCTTGGG - Intergenic
1199191912 X:144980818-144980840 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1199258643 X:145745294-145745316 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1199358401 X:146887271-146887293 GAGTGGTTACAGCAGGCCTTGGG + Intergenic
1199374142 X:147087861-147087883 GAGTGGTTACAGCAGTACTTGGG - Intergenic
1199498842 X:148486707-148486729 GTGTGGAGACAGAAGGTATATGG + Intergenic
1199792548 X:151168772-151168794 GAATGGATACAGATGTAATAAGG + Intergenic
1202595527 Y:26535208-26535230 GAGTGGTTACAGCAGGTCTTGGG + Intergenic